Incidental Mutation 'R7103:Hoxb2'
List |< first << previous [record 21 of 64] next >> last >|
ID551004
Institutional Source Beutler Lab
Gene Symbol Hoxb2
Ensembl Gene ENSMUSG00000075588
Gene Namehomeobox B2
SynonymsHoxbes2, Hox-2.8
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.770) question?
Stock #R7103 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location96350525-96354012 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 96353621 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 353 (F353L)
Ref Sequence ENSEMBL: ENSMUSP00000098092 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100523]
Predicted Effect possibly damaging
Transcript: ENSMUST00000100523
AA Change: F353L

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000098092
Gene: ENSMUSG00000075588
AA Change: F353L

DomainStartEndE-ValueType
low complexity region 76 94 N/A INTRINSIC
low complexity region 99 118 N/A INTRINSIC
HOX 141 203 2.54e-28 SMART
low complexity region 204 213 N/A INTRINSIC
low complexity region 317 330 N/A INTRINSIC
Meta Mutation Damage Score 0.1989 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Antp homeobox family and encodes a nuclear protein with a homeobox DNA-binding domain. It is included in a cluster of homeobox B genes located on chromosome 17. The encoded protein functions as a sequence-specific transcription factor that is involved in development. Increased expression of this gene is associated with pancreatic cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter allele die neonatally with altered segmental identity and abnormal migration of motor neurons in the hindbrain. Mice homozygous for null alleles can exhibit partial postnatal lethality, narrow face, runting, absent facial motor nuclei, and facial nerve/muscle defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 A G 11: 50,737,354 T294A probably damaging Het
Adamtsl2 G A 2: 27,107,461 V893I probably damaging Het
Amph T A 13: 19,149,738 D656E probably benign Het
Aoah T C 13: 21,023,315 F568S probably damaging Het
Atr G A 9: 95,865,372 G236S probably damaging Het
Brd3 T A 2: 27,450,394 Q601L probably damaging Het
Ccar2 T C 14: 70,141,977 E524G probably damaging Het
Cog2 T C 8: 124,541,114 probably null Het
Csnka2ip C A 16: 64,478,757 V415F unknown Het
Dmp1 A T 5: 104,211,863 D135V probably damaging Het
Dtna T C 18: 23,653,379 probably null Het
Endou A G 15: 97,718,929 S238P probably damaging Het
Ep400 T A 5: 110,733,785 E779D unknown Het
Fcgbp A G 7: 28,084,962 E149G probably benign Het
G6pc C A 11: 101,374,587 probably null Het
Gm13119 C T 4: 144,363,727 R446C probably benign Het
Gm9573 C A 17: 35,621,540 A585S unknown Het
Gmeb1 T C 4: 132,234,868 H160R probably damaging Het
Gramd1b T C 9: 40,401,606 Y22C unknown Het
Hcrtr2 C T 9: 76,254,511 G199D probably benign Het
Itpr2 C A 6: 146,325,074 V1391F probably damaging Het
Jakmip2 T A 18: 43,540,583 probably null Het
Kcnmb4 T C 10: 116,473,259 Y88C possibly damaging Het
Kif1a T C 1: 93,077,785 Y89C probably damaging Het
Kif23 T A 9: 61,919,892 K892N probably damaging Het
Lama3 T A 18: 12,531,879 S646T probably benign Het
Lig3 T A 11: 82,797,312 M709K probably benign Het
Mgea5 G A 19: 45,783,166 probably benign Het
Mindy3 C A 2: 12,401,074 A137S possibly damaging Het
Mis18bp1 T C 12: 65,149,283 E569G possibly damaging Het
Misp T A 10: 79,827,165 L472Q probably damaging Het
Mrps5 A T 2: 127,601,410 T303S probably damaging Het
Msh3 T G 13: 92,274,800 I630L probably benign Het
Myo16 A G 8: 10,569,673 Y1408C unknown Het
N4bp2 T C 5: 65,806,846 V746A probably benign Het
Olfr1225 A G 2: 89,170,483 I243T possibly damaging Het
Olfr1423 A G 19: 12,036,388 M118T probably damaging Het
Olfr477 A G 7: 107,990,598 T78A possibly damaging Het
Ostf1 C T 19: 18,596,351 M44I probably null Het
Pik3c2b T G 1: 133,105,974 L1572R probably damaging Het
Pilra T C 5: 137,831,226 D192G possibly damaging Het
Pkhd1l1 A G 15: 44,573,631 I3462V probably benign Het
Plekhh1 A G 12: 79,066,655 D619G probably benign Het
Ptprb T A 10: 116,338,813 Y797N probably damaging Het
Rb1 T C 14: 73,262,644 D521G probably damaging Het
Rnf17 T G 14: 56,471,306 F728V possibly damaging Het
Slc16a4 T C 3: 107,311,471 S463P probably damaging Het
Slc4a1 A T 11: 102,353,867 I634K probably damaging Het
Slc4a1ap T C 5: 31,543,857 V634A probably benign Het
Spam1 A G 6: 24,800,584 M441V probably benign Het
Teddm3 A C 16: 21,152,979 L280* probably null Het
Tmem231 T C 8: 111,918,885 probably null Het
Tom1l1 T C 11: 90,671,081 probably null Het
Topors C T 4: 40,261,706 G526D probably benign Het
Trpm6 A T 19: 18,813,547 I649F possibly damaging Het
Ttc16 T A 2: 32,774,428 M66L probably benign Het
Tubgcp6 A G 15: 89,101,029 F1619L probably damaging Het
Vps13d G T 4: 145,115,492 A2619E Het
Vps8 G A 16: 21,526,441 R838H probably damaging Het
Vwde T A 6: 13,215,800 M86L probably benign Het
Zfp64 A T 2: 168,926,437 D418E probably benign Het
Zfp952 C T 17: 33,003,632 P362S possibly damaging Het
Zglp1 T C 9: 21,066,072 E149G probably benign Het
Other mutations in Hoxb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02992:Hoxb2 APN 11 96353084 missense probably damaging 1.00
R3951:Hoxb2 UTSW 11 96353175 missense probably damaging 0.98
R6950:Hoxb2 UTSW 11 96351901 missense probably benign 0.34
R7673:Hoxb2 UTSW 11 96353457 missense possibly damaging 0.83
Z1177:Hoxb2 UTSW 11 96351989 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GGATTCGCCTTTTCTACCGG -3'
(R):5'- TTGTAAGAAAACCCTCTCCCACTAGAG -3'

Sequencing Primer
(F):5'- GGACCTCAATTTCTTCGCTGCAG -3'
(R):5'- CGTTGGAAGGAGTTTTACCAAG -3'
Posted On2019-05-15