Incidental Mutation 'R7103:Slc4a1'
ID 551005
Institutional Source Beutler Lab
Gene Symbol Slc4a1
Ensembl Gene ENSMUSG00000006574
Gene Name solute carrier family 4 (anion exchanger), member 1
Synonyms band 3, CD233, Ae1, erythrocyte membrane protein band 3, l11Jus51, Empb3
MMRRC Submission 045195-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7103 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 102239646-102256107 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 102244693 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 634 (I634K)
Ref Sequence ENSEMBL: ENSMUSP00000006749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006749]
AlphaFold P04919
Predicted Effect probably damaging
Transcript: ENSMUST00000006749
AA Change: I634K

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000006749
Gene: ENSMUSG00000006574
AA Change: I634K

DomainStartEndE-ValueType
low complexity region 58 68 N/A INTRINSIC
Pfam:Band_3_cyto 100 342 1.6e-81 PFAM
Pfam:HCO3_cotransp 391 584 5.7e-85 PFAM
Pfam:HCO3_cotransp 575 857 5.6e-118 PFAM
transmembrane domain 875 892 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the anion exchanger (AE) family and is expressed in the erythrocyte plasma membrane, where it functions as a chloride/bicarbonate exchanger involved in carbon dioxide transport from tissues to lungs. The protein comprises two domains that are structurally and functionally distinct. The N-terminal 40kDa domain is located in the cytoplasm and acts as an attachment site for the red cell skeleton by binding ankyrin. The glycosylated C-terminal membrane-associated domain contains 12-14 membrane spanning segments and carries out the stilbene disulphonate-sensitive exchange transport of anions. The cytoplasmic tail at the extreme C-terminus of the membrane domain binds carbonic anhydrase II. The encoded protein associates with the red cell membrane protein glycophorin A and this association promotes the correct folding and translocation of the exchanger. This protein is predominantly dimeric but forms tetramers in the presence of ankyrin. Many mutations in this gene are known in man, and these mutations can lead to two types of disease: destabilization of red cell membrane leading to hereditary spherocytosis, and defective kidney acid secretion leading to distal renal tubular acidosis. Other mutations that do not give rise to disease result in novel blood group antigens, which form the Diego blood group system. Southeast Asian ovalocytosis (SAO, Melanesian ovalocytosis) results from the heterozygous presence of a deletion in the encoded protein and is common in areas where Plasmodium falciparum malaria is endemic. One null mutation in this gene is known, resulting in very severe anemia and nephrocalcinosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for null mutations exhibit retarded growth, severe spherocytosis, hemolytic anemia, lack of erythrocyte glycophorin A, mitotic defects, and high postnatal mortality. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(3) Targeted, other(1) Spontaneous(1) Chemically induced(1)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 A G 11: 50,628,181 (GRCm39) T294A probably damaging Het
Adamtsl2 G A 2: 26,997,473 (GRCm39) V893I probably damaging Het
Amph T A 13: 19,333,908 (GRCm39) D656E probably benign Het
Aoah T C 13: 21,207,485 (GRCm39) F568S probably damaging Het
Atr G A 9: 95,747,425 (GRCm39) G236S probably damaging Het
Brd3 T A 2: 27,340,406 (GRCm39) Q601L probably damaging Het
Ccar2 T C 14: 70,379,426 (GRCm39) E524G probably damaging Het
Cog2 T C 8: 125,267,853 (GRCm39) probably null Het
Csnka2ip C A 16: 64,299,120 (GRCm39) V415F unknown Het
Dmp1 A T 5: 104,359,729 (GRCm39) D135V probably damaging Het
Dtna T C 18: 23,786,436 (GRCm39) probably null Het
Endou A G 15: 97,616,810 (GRCm39) S238P probably damaging Het
Ep400 T A 5: 110,881,651 (GRCm39) E779D unknown Het
Fcgbp A G 7: 27,784,387 (GRCm39) E149G probably benign Het
G6pc1 C A 11: 101,265,413 (GRCm39) probably null Het
Gmeb1 T C 4: 131,962,179 (GRCm39) H160R probably damaging Het
Gramd1b T C 9: 40,312,902 (GRCm39) Y22C unknown Het
Hcrtr2 C T 9: 76,161,793 (GRCm39) G199D probably benign Het
Hoxb2 T C 11: 96,244,447 (GRCm39) F353L possibly damaging Het
Itpr2 C A 6: 146,226,572 (GRCm39) V1391F probably damaging Het
Jakmip2 T A 18: 43,673,648 (GRCm39) probably null Het
Kcnmb4 T C 10: 116,309,164 (GRCm39) Y88C possibly damaging Het
Kif1a T C 1: 93,005,507 (GRCm39) Y89C probably damaging Het
Kif23 T A 9: 61,827,174 (GRCm39) K892N probably damaging Het
Lama3 T A 18: 12,664,936 (GRCm39) S646T probably benign Het
Lig3 T A 11: 82,688,138 (GRCm39) M709K probably benign Het
Mindy3 C A 2: 12,405,885 (GRCm39) A137S possibly damaging Het
Mis18bp1 T C 12: 65,196,057 (GRCm39) E569G possibly damaging Het
Misp T A 10: 79,662,999 (GRCm39) L472Q probably damaging Het
Mrps5 A T 2: 127,443,330 (GRCm39) T303S probably damaging Het
Msh3 T G 13: 92,411,308 (GRCm39) I630L probably benign Het
Muc21 C A 17: 35,932,432 (GRCm39) A585S unknown Het
Myo16 A G 8: 10,619,673 (GRCm39) Y1408C unknown Het
N4bp2 T C 5: 65,964,189 (GRCm39) V746A probably benign Het
Oga G A 19: 45,771,605 (GRCm39) probably benign Het
Or4c120 A G 2: 89,000,827 (GRCm39) I243T possibly damaging Het
Or4d11 A G 19: 12,013,752 (GRCm39) M118T probably damaging Het
Or5p56 A G 7: 107,589,805 (GRCm39) T78A possibly damaging Het
Ostf1 C T 19: 18,573,715 (GRCm39) M44I probably null Het
Pik3c2b T G 1: 133,033,712 (GRCm39) L1572R probably damaging Het
Pilra T C 5: 137,829,488 (GRCm39) D192G possibly damaging Het
Pkhd1l1 A G 15: 44,437,027 (GRCm39) I3462V probably benign Het
Plekhh1 A G 12: 79,113,429 (GRCm39) D619G probably benign Het
Pramel31 C T 4: 144,090,297 (GRCm39) R446C probably benign Het
Ptprb T A 10: 116,174,718 (GRCm39) Y797N probably damaging Het
Rb1 T C 14: 73,500,084 (GRCm39) D521G probably damaging Het
Rnf17 T G 14: 56,708,763 (GRCm39) F728V possibly damaging Het
Slc16a4 T C 3: 107,218,787 (GRCm39) S463P probably damaging Het
Slc4a1ap T C 5: 31,701,201 (GRCm39) V634A probably benign Het
Spam1 A G 6: 24,800,583 (GRCm39) M441V probably benign Het
Teddm3 A C 16: 20,971,729 (GRCm39) L280* probably null Het
Tmem231 T C 8: 112,645,517 (GRCm39) probably null Het
Tom1l1 T C 11: 90,561,907 (GRCm39) probably null Het
Topors C T 4: 40,261,706 (GRCm39) G526D probably benign Het
Trpm6 A T 19: 18,790,911 (GRCm39) I649F possibly damaging Het
Ttc16 T A 2: 32,664,440 (GRCm39) M66L probably benign Het
Tubgcp6 A G 15: 88,985,232 (GRCm39) F1619L probably damaging Het
Vps13d G T 4: 144,842,062 (GRCm39) A2619E Het
Vps8 G A 16: 21,345,191 (GRCm39) R838H probably damaging Het
Vwde T A 6: 13,215,799 (GRCm39) M86L probably benign Het
Zfp64 A T 2: 168,768,357 (GRCm39) D418E probably benign Het
Zfp952 C T 17: 33,222,606 (GRCm39) P362S possibly damaging Het
Zglp1 T C 9: 20,977,368 (GRCm39) E149G probably benign Het
Other mutations in Slc4a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01303:Slc4a1 APN 11 102,248,790 (GRCm39) missense probably benign 0.09
IGL01845:Slc4a1 APN 11 102,244,729 (GRCm39) missense probably benign 0.01
IGL02166:Slc4a1 APN 11 102,245,159 (GRCm39) missense probably damaging 1.00
IGL02745:Slc4a1 APN 11 102,247,093 (GRCm39) missense probably damaging 1.00
IGL02801:Slc4a1 APN 11 102,249,972 (GRCm39) critical splice acceptor site probably null
Rumor UTSW 11 102,252,048 (GRCm39) nonsense probably null
A5278:Slc4a1 UTSW 11 102,244,641 (GRCm39) splice site probably benign
R0011:Slc4a1 UTSW 11 102,247,936 (GRCm39) missense possibly damaging 0.51
R0193:Slc4a1 UTSW 11 102,243,510 (GRCm39) missense possibly damaging 0.91
R0445:Slc4a1 UTSW 11 102,245,192 (GRCm39) missense probably benign 0.04
R0599:Slc4a1 UTSW 11 102,248,741 (GRCm39) splice site probably benign
R0635:Slc4a1 UTSW 11 102,243,498 (GRCm39) missense possibly damaging 0.78
R1496:Slc4a1 UTSW 11 102,251,997 (GRCm39) missense probably benign
R1816:Slc4a1 UTSW 11 102,242,056 (GRCm39) missense probably damaging 1.00
R1898:Slc4a1 UTSW 11 102,241,133 (GRCm39) missense probably damaging 1.00
R2361:Slc4a1 UTSW 11 102,247,656 (GRCm39) missense probably damaging 1.00
R2381:Slc4a1 UTSW 11 102,250,128 (GRCm39) missense probably benign 0.00
R3806:Slc4a1 UTSW 11 102,248,019 (GRCm39) missense probably benign 0.00
R3857:Slc4a1 UTSW 11 102,247,947 (GRCm39) missense probably benign 0.01
R3858:Slc4a1 UTSW 11 102,247,947 (GRCm39) missense probably benign 0.01
R4585:Slc4a1 UTSW 11 102,252,245 (GRCm39) utr 5 prime probably benign
R4586:Slc4a1 UTSW 11 102,252,245 (GRCm39) utr 5 prime probably benign
R4705:Slc4a1 UTSW 11 102,247,084 (GRCm39) missense possibly damaging 0.89
R4914:Slc4a1 UTSW 11 102,243,279 (GRCm39) missense probably damaging 1.00
R4915:Slc4a1 UTSW 11 102,243,279 (GRCm39) missense probably damaging 1.00
R4916:Slc4a1 UTSW 11 102,243,279 (GRCm39) missense probably damaging 1.00
R4918:Slc4a1 UTSW 11 102,243,279 (GRCm39) missense probably damaging 1.00
R5001:Slc4a1 UTSW 11 102,242,329 (GRCm39) missense probably benign 0.12
R5103:Slc4a1 UTSW 11 102,244,087 (GRCm39) missense possibly damaging 0.65
R5234:Slc4a1 UTSW 11 102,252,209 (GRCm39) missense probably benign 0.03
R5308:Slc4a1 UTSW 11 102,249,903 (GRCm39) missense probably damaging 0.98
R5315:Slc4a1 UTSW 11 102,249,080 (GRCm39) missense possibly damaging 0.77
R5478:Slc4a1 UTSW 11 102,241,140 (GRCm39) missense probably damaging 0.98
R5521:Slc4a1 UTSW 11 102,244,092 (GRCm39) missense probably benign 0.01
R5888:Slc4a1 UTSW 11 102,247,351 (GRCm39) missense probably damaging 0.98
R6011:Slc4a1 UTSW 11 102,243,357 (GRCm39) missense probably damaging 1.00
R6547:Slc4a1 UTSW 11 102,247,561 (GRCm39) missense probably damaging 0.99
R6629:Slc4a1 UTSW 11 102,252,048 (GRCm39) nonsense probably null
R6717:Slc4a1 UTSW 11 102,245,249 (GRCm39) missense probably damaging 0.99
R7051:Slc4a1 UTSW 11 102,247,084 (GRCm39) missense probably benign 0.12
R7315:Slc4a1 UTSW 11 102,247,310 (GRCm39) missense probably damaging 1.00
R7331:Slc4a1 UTSW 11 102,252,245 (GRCm39) start gained probably benign
R7582:Slc4a1 UTSW 11 102,243,403 (GRCm39) missense probably damaging 0.99
R8560:Slc4a1 UTSW 11 102,244,083 (GRCm39) missense possibly damaging 0.94
R9036:Slc4a1 UTSW 11 102,243,279 (GRCm39) missense probably damaging 1.00
R9274:Slc4a1 UTSW 11 102,242,047 (GRCm39) missense probably benign 0.00
R9502:Slc4a1 UTSW 11 102,247,674 (GRCm39) missense probably damaging 0.97
R9568:Slc4a1 UTSW 11 102,247,680 (GRCm39) missense probably damaging 1.00
R9585:Slc4a1 UTSW 11 102,247,915 (GRCm39) missense probably benign 0.08
R9651:Slc4a1 UTSW 11 102,242,256 (GRCm39) missense probably damaging 1.00
RF006:Slc4a1 UTSW 11 102,247,542 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AATGCGCACCCTCTCCTATG -3'
(R):5'- ATAGCTGGAGTAATGGTAGACTTGG -3'

Sequencing Primer
(F):5'- TCTTGAGGGAATATTGGAAGACC -3'
(R):5'- AGACTTGGTTCTTGATGGACCTCTC -3'
Posted On 2019-05-15