Incidental Mutation 'R7103:Mis18bp1'
List |< first << previous [record 31 of 64] next >> last >|
ID551006
Institutional Source Beutler Lab
Gene Symbol Mis18bp1
Ensembl Gene ENSMUSG00000047534
Gene NameMIS18 binding protein 1
SynonymsC79407
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7103 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location65132734-65172604 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65149283 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 569 (E569G)
Ref Sequence ENSEMBL: ENSMUSP00000052109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052201] [ENSMUST00000221296] [ENSMUST00000222244]
Predicted Effect possibly damaging
Transcript: ENSMUST00000052201
AA Change: E569G

PolyPhen 2 Score 0.608 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000052109
Gene: ENSMUSG00000047534
AA Change: E569G

DomainStartEndE-ValueType
low complexity region 319 332 N/A INTRINSIC
Pfam:SANTA 336 425 1.4e-27 PFAM
coiled coil region 428 448 N/A INTRINSIC
coiled coil region 645 668 N/A INTRINSIC
SANT 742 794 9.48e-6 SMART
low complexity region 874 884 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000221296
Predicted Effect probably benign
Transcript: ENSMUST00000222244
Meta Mutation Damage Score 0.0902 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 A G 11: 50,737,354 T294A probably damaging Het
Adamtsl2 G A 2: 27,107,461 V893I probably damaging Het
Amph T A 13: 19,149,738 D656E probably benign Het
Aoah T C 13: 21,023,315 F568S probably damaging Het
Atr G A 9: 95,865,372 G236S probably damaging Het
Brd3 T A 2: 27,450,394 Q601L probably damaging Het
Ccar2 T C 14: 70,141,977 E524G probably damaging Het
Cog2 T C 8: 124,541,114 probably null Het
Csnka2ip C A 16: 64,478,757 V415F unknown Het
Dmp1 A T 5: 104,211,863 D135V probably damaging Het
Dtna T C 18: 23,653,379 probably null Het
Endou A G 15: 97,718,929 S238P probably damaging Het
Ep400 T A 5: 110,733,785 E779D unknown Het
Fcgbp A G 7: 28,084,962 E149G probably benign Het
G6pc C A 11: 101,374,587 probably null Het
Gm13119 C T 4: 144,363,727 R446C probably benign Het
Gm9573 C A 17: 35,621,540 A585S unknown Het
Gmeb1 T C 4: 132,234,868 H160R probably damaging Het
Gramd1b T C 9: 40,401,606 Y22C unknown Het
Hcrtr2 C T 9: 76,254,511 G199D probably benign Het
Hoxb2 T C 11: 96,353,621 F353L possibly damaging Het
Itpr2 C A 6: 146,325,074 V1391F probably damaging Het
Jakmip2 T A 18: 43,540,583 probably null Het
Kcnmb4 T C 10: 116,473,259 Y88C possibly damaging Het
Kif1a T C 1: 93,077,785 Y89C probably damaging Het
Kif23 T A 9: 61,919,892 K892N probably damaging Het
Lama3 T A 18: 12,531,879 S646T probably benign Het
Lig3 T A 11: 82,797,312 M709K probably benign Het
Mgea5 G A 19: 45,783,166 probably benign Het
Mindy3 C A 2: 12,401,074 A137S possibly damaging Het
Misp T A 10: 79,827,165 L472Q probably damaging Het
Mrps5 A T 2: 127,601,410 T303S probably damaging Het
Msh3 T G 13: 92,274,800 I630L probably benign Het
Myo16 A G 8: 10,569,673 Y1408C unknown Het
N4bp2 T C 5: 65,806,846 V746A probably benign Het
Olfr1225 A G 2: 89,170,483 I243T possibly damaging Het
Olfr1423 A G 19: 12,036,388 M118T probably damaging Het
Olfr477 A G 7: 107,990,598 T78A possibly damaging Het
Ostf1 C T 19: 18,596,351 M44I probably null Het
Pik3c2b T G 1: 133,105,974 L1572R probably damaging Het
Pilra T C 5: 137,831,226 D192G possibly damaging Het
Pkhd1l1 A G 15: 44,573,631 I3462V probably benign Het
Plekhh1 A G 12: 79,066,655 D619G probably benign Het
Ptprb T A 10: 116,338,813 Y797N probably damaging Het
Rb1 T C 14: 73,262,644 D521G probably damaging Het
Rnf17 T G 14: 56,471,306 F728V possibly damaging Het
Slc16a4 T C 3: 107,311,471 S463P probably damaging Het
Slc4a1 A T 11: 102,353,867 I634K probably damaging Het
Slc4a1ap T C 5: 31,543,857 V634A probably benign Het
Spam1 A G 6: 24,800,584 M441V probably benign Het
Teddm3 A C 16: 21,152,979 L280* probably null Het
Tmem231 T C 8: 111,918,885 probably null Het
Tom1l1 T C 11: 90,671,081 probably null Het
Topors C T 4: 40,261,706 G526D probably benign Het
Trpm6 A T 19: 18,813,547 I649F possibly damaging Het
Ttc16 T A 2: 32,774,428 M66L probably benign Het
Tubgcp6 A G 15: 89,101,029 F1619L probably damaging Het
Vps13d G T 4: 145,115,492 A2619E Het
Vps8 G A 16: 21,526,441 R838H probably damaging Het
Vwde T A 6: 13,215,800 M86L probably benign Het
Zfp64 A T 2: 168,926,437 D418E probably benign Het
Zfp952 C T 17: 33,003,632 P362S possibly damaging Het
Zglp1 T C 9: 21,066,072 E149G probably benign Het
Other mutations in Mis18bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Mis18bp1 APN 12 65158441 missense possibly damaging 0.68
IGL01383:Mis18bp1 APN 12 65148989 missense probably benign 0.05
IGL01736:Mis18bp1 APN 12 65138678 missense probably damaging 1.00
IGL02037:Mis18bp1 APN 12 65136748 critical splice donor site probably null
IGL02210:Mis18bp1 APN 12 65136831 nonsense probably null
IGL02318:Mis18bp1 APN 12 65158741 missense probably benign 0.04
IGL02541:Mis18bp1 APN 12 65161460 missense probably damaging 0.97
IGL02664:Mis18bp1 APN 12 65153880 nonsense probably null
IGL02838:Mis18bp1 APN 12 65136826 missense probably damaging 0.99
IGL03031:Mis18bp1 APN 12 65161930 missense probably benign
PIT4453001:Mis18bp1 UTSW 12 65158673 missense probably damaging 0.98
R0555:Mis18bp1 UTSW 12 65161453 missense possibly damaging 0.94
R1169:Mis18bp1 UTSW 12 65143283 nonsense probably null
R1517:Mis18bp1 UTSW 12 65133813 missense probably benign 0.03
R1702:Mis18bp1 UTSW 12 65161744 missense probably benign
R1705:Mis18bp1 UTSW 12 65149339 missense probably benign 0.19
R1888:Mis18bp1 UTSW 12 65149328 missense probably benign 0.01
R1888:Mis18bp1 UTSW 12 65149328 missense probably benign 0.01
R1973:Mis18bp1 UTSW 12 65149076 nonsense probably null
R1990:Mis18bp1 UTSW 12 65158694 missense probably benign 0.03
R2023:Mis18bp1 UTSW 12 65149109 missense probably damaging 0.97
R2043:Mis18bp1 UTSW 12 65149418 missense probably damaging 1.00
R2318:Mis18bp1 UTSW 12 65140843 missense possibly damaging 0.92
R2897:Mis18bp1 UTSW 12 65133586 missense probably benign 0.09
R3120:Mis18bp1 UTSW 12 65156988 splice site probably null
R3845:Mis18bp1 UTSW 12 65149142 missense possibly damaging 0.61
R4578:Mis18bp1 UTSW 12 65153881 missense probably damaging 1.00
R4590:Mis18bp1 UTSW 12 65158506 missense possibly damaging 0.50
R4614:Mis18bp1 UTSW 12 65153529 intron probably benign
R4626:Mis18bp1 UTSW 12 65140766 missense probably damaging 1.00
R4724:Mis18bp1 UTSW 12 65158739 missense probably benign 0.18
R4873:Mis18bp1 UTSW 12 65161435 missense probably benign 0.23
R4875:Mis18bp1 UTSW 12 65161435 missense probably benign 0.23
R5173:Mis18bp1 UTSW 12 65149375 missense possibly damaging 0.96
R5294:Mis18bp1 UTSW 12 65157043 missense probably damaging 1.00
R5540:Mis18bp1 UTSW 12 65148746 missense possibly damaging 0.83
R5560:Mis18bp1 UTSW 12 65152816 missense possibly damaging 0.83
R5584:Mis18bp1 UTSW 12 65154776 missense probably damaging 0.98
R5661:Mis18bp1 UTSW 12 65148852 missense probably benign 0.41
R6235:Mis18bp1 UTSW 12 65158408 missense probably damaging 0.99
R6282:Mis18bp1 UTSW 12 65149163 missense probably benign 0.01
R6284:Mis18bp1 UTSW 12 65138787 missense probably benign 0.32
R6378:Mis18bp1 UTSW 12 65149247 missense probably benign 0.11
R6418:Mis18bp1 UTSW 12 65158543 missense possibly damaging 0.64
R7244:Mis18bp1 UTSW 12 65161630 missense probably damaging 0.96
R7371:Mis18bp1 UTSW 12 65158594 missense probably benign 0.18
R7623:Mis18bp1 UTSW 12 65148852 missense probably benign 0.05
R7845:Mis18bp1 UTSW 12 65149328 missense probably benign 0.01
R7898:Mis18bp1 UTSW 12 65149472 missense probably benign 0.41
R7912:Mis18bp1 UTSW 12 65152758 missense possibly damaging 0.92
R8057:Mis18bp1 UTSW 12 65148899 missense possibly damaging 0.56
R8403:Mis18bp1 UTSW 12 65154811 missense possibly damaging 0.87
X0058:Mis18bp1 UTSW 12 65149226 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAGGACCGGCAATACTGTGATAC -3'
(R):5'- AGAAGACACCCGCTTCTCAG -3'

Sequencing Primer
(F):5'- CGGCAATACTGTGATACACCTATTTG -3'
(R):5'- TCTCAGTCAGAAGAGAGCTTATG -3'
Posted On2019-05-15