Incidental Mutation 'R7103:Plekhh1'
ID551007
Institutional Source Beutler Lab
Gene Symbol Plekhh1
Ensembl Gene ENSMUSG00000060716
Gene Namepleckstrin homology domain containing, family H (with MyTH4 domain) member 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7103 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location79029163-79081655 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79066655 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 619 (D619G)
Ref Sequence ENSEMBL: ENSMUSP00000049460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039928] [ENSMUST00000219956]
Predicted Effect probably benign
Transcript: ENSMUST00000039928
AA Change: D619G

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000049460
Gene: ENSMUSG00000060716
AA Change: D619G

DomainStartEndE-ValueType
coiled coil region 26 172 N/A INTRINSIC
low complexity region 363 379 N/A INTRINSIC
low complexity region 489 500 N/A INTRINSIC
PH 573 668 1.15e-22 SMART
PH 682 792 3.23e-8 SMART
MyTH4 826 980 3e-48 SMART
B41 987 1224 6.07e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000219956
AA Change: D619G

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 A G 11: 50,737,354 T294A probably damaging Het
Adamtsl2 G A 2: 27,107,461 V893I probably damaging Het
Amph T A 13: 19,149,738 D656E probably benign Het
Aoah T C 13: 21,023,315 F568S probably damaging Het
Atr G A 9: 95,865,372 G236S probably damaging Het
Brd3 T A 2: 27,450,394 Q601L probably damaging Het
Ccar2 T C 14: 70,141,977 E524G probably damaging Het
Cog2 T C 8: 124,541,114 probably null Het
Csnka2ip C A 16: 64,478,757 V415F unknown Het
Dmp1 A T 5: 104,211,863 D135V probably damaging Het
Dtna T C 18: 23,653,379 probably null Het
Endou A G 15: 97,718,929 S238P probably damaging Het
Ep400 T A 5: 110,733,785 E779D unknown Het
Fcgbp A G 7: 28,084,962 E149G probably benign Het
G6pc C A 11: 101,374,587 probably null Het
Gm13119 C T 4: 144,363,727 R446C probably benign Het
Gm9573 C A 17: 35,621,540 A585S unknown Het
Gmeb1 T C 4: 132,234,868 H160R probably damaging Het
Gramd1b T C 9: 40,401,606 Y22C unknown Het
Hcrtr2 C T 9: 76,254,511 G199D probably benign Het
Hoxb2 T C 11: 96,353,621 F353L possibly damaging Het
Itpr2 C A 6: 146,325,074 V1391F probably damaging Het
Jakmip2 T A 18: 43,540,583 probably null Het
Kcnmb4 T C 10: 116,473,259 Y88C possibly damaging Het
Kif1a T C 1: 93,077,785 Y89C probably damaging Het
Kif23 T A 9: 61,919,892 K892N probably damaging Het
Lama3 T A 18: 12,531,879 S646T probably benign Het
Lig3 T A 11: 82,797,312 M709K probably benign Het
Mgea5 G A 19: 45,783,166 probably benign Het
Mindy3 C A 2: 12,401,074 A137S possibly damaging Het
Mis18bp1 T C 12: 65,149,283 E569G possibly damaging Het
Misp T A 10: 79,827,165 L472Q probably damaging Het
Mrps5 A T 2: 127,601,410 T303S probably damaging Het
Msh3 T G 13: 92,274,800 I630L probably benign Het
Myo16 A G 8: 10,569,673 Y1408C unknown Het
N4bp2 T C 5: 65,806,846 V746A probably benign Het
Olfr1225 A G 2: 89,170,483 I243T possibly damaging Het
Olfr1423 A G 19: 12,036,388 M118T probably damaging Het
Olfr477 A G 7: 107,990,598 T78A possibly damaging Het
Ostf1 C T 19: 18,596,351 M44I probably null Het
Pik3c2b T G 1: 133,105,974 L1572R probably damaging Het
Pilra T C 5: 137,831,226 D192G possibly damaging Het
Pkhd1l1 A G 15: 44,573,631 I3462V probably benign Het
Ptprb T A 10: 116,338,813 Y797N probably damaging Het
Rb1 T C 14: 73,262,644 D521G probably damaging Het
Rnf17 T G 14: 56,471,306 F728V possibly damaging Het
Slc16a4 T C 3: 107,311,471 S463P probably damaging Het
Slc4a1 A T 11: 102,353,867 I634K probably damaging Het
Slc4a1ap T C 5: 31,543,857 V634A probably benign Het
Spam1 A G 6: 24,800,584 M441V probably benign Het
Teddm3 A C 16: 21,152,979 L280* probably null Het
Tmem231 T C 8: 111,918,885 probably null Het
Tom1l1 T C 11: 90,671,081 probably null Het
Topors C T 4: 40,261,706 G526D probably benign Het
Trpm6 A T 19: 18,813,547 I649F possibly damaging Het
Ttc16 T A 2: 32,774,428 M66L probably benign Het
Tubgcp6 A G 15: 89,101,029 F1619L probably damaging Het
Vps13d G T 4: 145,115,492 A2619E Het
Vps8 G A 16: 21,526,441 R838H probably damaging Het
Vwde T A 6: 13,215,800 M86L probably benign Het
Zfp64 A T 2: 168,926,437 D418E probably benign Het
Zfp952 C T 17: 33,003,632 P362S possibly damaging Het
Zglp1 T C 9: 21,066,072 E149G probably benign Het
Other mutations in Plekhh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01707:Plekhh1 APN 12 79078964 missense probably benign 0.35
IGL01764:Plekhh1 APN 12 79054905 missense probably benign 0.00
IGL01922:Plekhh1 APN 12 79079579 missense probably benign
IGL02187:Plekhh1 APN 12 79072818 missense probably damaging 1.00
IGL02406:Plekhh1 APN 12 79069009 splice site probably benign
IGL02581:Plekhh1 APN 12 79079108 critical splice donor site probably null
IGL03201:Plekhh1 APN 12 79053656 missense probably damaging 1.00
R0088:Plekhh1 UTSW 12 79055366 missense probably benign 0.00
R0626:Plekhh1 UTSW 12 79040585 nonsense probably null
R0662:Plekhh1 UTSW 12 79078993 missense probably benign 0.09
R0666:Plekhh1 UTSW 12 79069115 missense probably damaging 0.99
R0966:Plekhh1 UTSW 12 79065730 missense probably damaging 1.00
R1027:Plekhh1 UTSW 12 79054482 splice site probably benign
R1507:Plekhh1 UTSW 12 79079450 missense probably damaging 1.00
R1562:Plekhh1 UTSW 12 79076708 missense probably benign 0.00
R1759:Plekhh1 UTSW 12 79072761 missense probably damaging 1.00
R1839:Plekhh1 UTSW 12 79078957 splice site probably benign
R2125:Plekhh1 UTSW 12 79079000 missense probably damaging 1.00
R2345:Plekhh1 UTSW 12 79053647 missense probably damaging 1.00
R3895:Plekhh1 UTSW 12 79055232 missense probably benign
R3927:Plekhh1 UTSW 12 79053648 missense probably damaging 1.00
R4039:Plekhh1 UTSW 12 79055183 missense probably benign 0.01
R4720:Plekhh1 UTSW 12 79075420 frame shift probably null
R4721:Plekhh1 UTSW 12 79075420 frame shift probably null
R4824:Plekhh1 UTSW 12 79054803 missense probably benign
R4869:Plekhh1 UTSW 12 79050386 missense probably benign
R5114:Plekhh1 UTSW 12 79069106 missense probably benign 0.00
R5809:Plekhh1 UTSW 12 79078687 missense probably benign 0.26
R6540:Plekhh1 UTSW 12 79064489 missense probably benign 0.14
R6977:Plekhh1 UTSW 12 79065717 missense probably damaging 1.00
R7058:Plekhh1 UTSW 12 79075430 missense probably damaging 1.00
R7120:Plekhh1 UTSW 12 79070939 missense probably benign 0.03
R7134:Plekhh1 UTSW 12 79062616 missense probably benign 0.00
R7209:Plekhh1 UTSW 12 79050376 missense probably benign 0.04
R7403:Plekhh1 UTSW 12 79040577 nonsense probably null
R7405:Plekhh1 UTSW 12 79055047 missense probably benign 0.00
R7449:Plekhh1 UTSW 12 79079552 missense probably benign 0.00
R7594:Plekhh1 UTSW 12 79076503 missense possibly damaging 0.89
R7648:Plekhh1 UTSW 12 79055131 missense probably benign 0.20
R7756:Plekhh1 UTSW 12 79070804 missense probably benign 0.15
R7758:Plekhh1 UTSW 12 79070804 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- ACTAGGAGTGCTTTATAGATGGGC -3'
(R):5'- CCTGGTATGATATCATCCATTCGTG -3'

Sequencing Primer
(F):5'- GCTTTATAGATGGGCTTCTAATCCAG -3'
(R):5'- ATCATCCATTCGTGTTTATTTTTGC -3'
Posted On2019-05-15