Mutagenetix > Incidental Mutation

Incidental Mutation 'R7103:Amph'

551008

Institutional Source

Beutler Lab

Gene Symbol

Amph

Ensembl Gene

ENSMUSG00000021314

Gene Name

amphiphysin

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.301) question?

Stock #

R7103 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

18948205-19150921 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 19149738 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 656 (D656E)

Ref Sequence

ENSEMBL: ENSMUSP00000142766 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003345] [ENSMUST00000200466]

AlphaFold

Q7TQF7

Predicted Effect

probably benign
Transcript: ENSMUST00000003345
AA Change: D652E

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000003345
Gene: ENSMUSG00000021314
AA Change: D652E

Domain	Start	End	E-Value	Type
BAR	12	233	8.47e-80	SMART
low complexity region	260	277	N/A	INTRINSIC
low complexity region	282	295	N/A	INTRINSIC
low complexity region	301	315	N/A	INTRINSIC
low complexity region	341	362	N/A	INTRINSIC
low complexity region	424	445	N/A	INTRINSIC
low complexity region	479	499	N/A	INTRINSIC
SH3	616	686	7.82e-10	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000200466
AA Change: D656E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000142766
Gene: ENSMUSG00000021314
AA Change: D656E

Domain	Start	End	E-Value	Type
BAR	12	233	2.3e-82	SMART
low complexity region	260	277	N/A	INTRINSIC
low complexity region	282	295	N/A	INTRINSIC
low complexity region	301	315	N/A	INTRINSIC
low complexity region	341	362	N/A	INTRINSIC
low complexity region	428	449	N/A	INTRINSIC
low complexity region	483	503	N/A	INTRINSIC
SH3	620	690	4.9e-12	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

98% (61/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein associated with the cytoplasmic surface of synaptic vesicles. A subset of patients with stiff-man syndrome who were also affected by breast cancer are positive for autoantibodies against this protein. Alternate splicing of this gene results in two transcript variants encoding different isoforms. Additional splice variants have been described, but their full length sequences have not been determined. A pseudogene of this gene is found on chromosome 11.[provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for a targeted mutation of this gene exhibit learning deficits and synaptic vesicle recycling defects, and die between 2 to 5 months of age from rare irreversible seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts2	A	G	11: 50,737,354	T294A	probably damaging	Het
Adamtsl2	G	A	2: 27,107,461	V893I	probably damaging	Het
Aoah	T	C	13: 21,023,315	F568S	probably damaging	Het
Atr	G	A	9: 95,865,372	G236S	probably damaging	Het
Brd3	T	A	2: 27,450,394	Q601L	probably damaging	Het
Ccar2	T	C	14: 70,141,977	E524G	probably damaging	Het
Cog2	T	C	8: 124,541,114		probably null	Het
Csnka2ip	C	A	16: 64,478,757	V415F	unknown	Het
Dmp1	A	T	5: 104,211,863	D135V	probably damaging	Het
Dtna	T	C	18: 23,653,379		probably null	Het
Endou	A	G	15: 97,718,929	S238P	probably damaging	Het
Ep400	T	A	5: 110,733,785	E779D	unknown	Het
Fcgbp	A	G	7: 28,084,962	E149G	probably benign	Het
G6pc	C	A	11: 101,374,587		probably null	Het
Gm13119	C	T	4: 144,363,727	R446C	probably benign	Het
Gm9573	C	A	17: 35,621,540	A585S	unknown	Het
Gmeb1	T	C	4: 132,234,868	H160R	probably damaging	Het
Gramd1b	T	C	9: 40,401,606	Y22C	unknown	Het
Hcrtr2	C	T	9: 76,254,511	G199D	probably benign	Het
Hoxb2	T	C	11: 96,353,621	F353L	possibly damaging	Het
Itpr2	C	A	6: 146,325,074	V1391F	probably damaging	Het
Jakmip2	T	A	18: 43,540,583		probably null	Het
Kcnmb4	T	C	10: 116,473,259	Y88C	possibly damaging	Het
Kif1a	T	C	1: 93,077,785	Y89C	probably damaging	Het
Kif23	T	A	9: 61,919,892	K892N	probably damaging	Het
Lama3	T	A	18: 12,531,879	S646T	probably benign	Het
Lig3	T	A	11: 82,797,312	M709K	probably benign	Het
Mgea5	G	A	19: 45,783,166		probably benign	Het
Mindy3	C	A	2: 12,401,074	A137S	possibly damaging	Het
Mis18bp1	T	C	12: 65,149,283	E569G	possibly damaging	Het
Misp	T	A	10: 79,827,165	L472Q	probably damaging	Het
Mrps5	A	T	2: 127,601,410	T303S	probably damaging	Het
Msh3	T	G	13: 92,274,800	I630L	probably benign	Het
Myo16	A	G	8: 10,569,673	Y1408C	unknown	Het
N4bp2	T	C	5: 65,806,846	V746A	probably benign	Het
Olfr1225	A	G	2: 89,170,483	I243T	possibly damaging	Het
Olfr1423	A	G	19: 12,036,388	M118T	probably damaging	Het
Olfr477	A	G	7: 107,990,598	T78A	possibly damaging	Het
Ostf1	C	T	19: 18,596,351	M44I	probably null	Het
Pik3c2b	T	G	1: 133,105,974	L1572R	probably damaging	Het
Pilra	T	C	5: 137,831,226	D192G	possibly damaging	Het
Pkhd1l1	A	G	15: 44,573,631	I3462V	probably benign	Het
Plekhh1	A	G	12: 79,066,655	D619G	probably benign	Het
Ptprb	T	A	10: 116,338,813	Y797N	probably damaging	Het
Rb1	T	C	14: 73,262,644	D521G	probably damaging	Het
Rnf17	T	G	14: 56,471,306	F728V	possibly damaging	Het
Slc16a4	T	C	3: 107,311,471	S463P	probably damaging	Het
Slc4a1	A	T	11: 102,353,867	I634K	probably damaging	Het
Slc4a1ap	T	C	5: 31,543,857	V634A	probably benign	Het
Spam1	A	G	6: 24,800,584	M441V	probably benign	Het
Teddm3	A	C	16: 21,152,979	L280*	probably null	Het
Tmem231	T	C	8: 111,918,885		probably null	Het
Tom1l1	T	C	11: 90,671,081		probably null	Het
Topors	C	T	4: 40,261,706	G526D	probably benign	Het
Trpm6	A	T	19: 18,813,547	I649F	possibly damaging	Het
Ttc16	T	A	2: 32,774,428	M66L	probably benign	Het
Tubgcp6	A	G	15: 89,101,029	F1619L	probably damaging	Het
Vps13d	G	T	4: 145,115,492	A2619E		Het
Vps8	G	A	16: 21,526,441	R838H	probably damaging	Het
Vwde	T	A	6: 13,215,800	M86L	probably benign	Het
Zfp64	A	T	2: 168,926,437	D418E	probably benign	Het
Zfp952	C	T	17: 33,003,632	P362S	possibly damaging	Het
Zglp1	T	C	9: 21,066,072	E149G	probably benign	Het

Other mutations in Amph

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00540:Amph	APN	13	19120606	missense	probably damaging	1.00
IGL01866:Amph	APN	13	19142002	missense	probably damaging	1.00
IGL02157:Amph	APN	13	19104231	missense	possibly damaging	0.60
IGL02300:Amph	APN	13	19086604	missense	probably damaging	1.00
IGL02435:Amph	APN	13	19139163	splice site	probably benign
IGL03060:Amph	APN	13	19094814	missense	probably damaging	0.99
IGL03122:Amph	APN	13	19102943	missense	probably damaging	0.98
R0037:Amph	UTSW	13	19100653	missense	possibly damaging	0.90
R0646:Amph	UTSW	13	19113116	missense	possibly damaging	0.95
R0652:Amph	UTSW	13	19086621	splice site	probably null
R1005:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1006:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1199:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1200:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1201:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1333:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1334:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1335:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1337:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1338:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1384:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1397:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1501:Amph	UTSW	13	19104291	nonsense	probably null
R1528:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1822:Amph	UTSW	13	18948455	missense	probably damaging	0.98
R2004:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R2006:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R2061:Amph	UTSW	13	19125035	nonsense	probably null
R2111:Amph	UTSW	13	19116266	splice site	probably benign
R2329:Amph	UTSW	13	19139350	missense	probably benign
R2878:Amph	UTSW	13	19104267	missense	possibly damaging	0.95
R3121:Amph	UTSW	13	19113146	nonsense	probably null
R3548:Amph	UTSW	13	19102959	missense	probably damaging	1.00
R4059:Amph	UTSW	13	19141998	missense	probably damaging	1.00
R4369:Amph	UTSW	13	19137700	missense	probably benign	0.20
R4492:Amph	UTSW	13	19149758	missense	possibly damaging	0.76
R4855:Amph	UTSW	13	19084208	missense	probably damaging	1.00
R4937:Amph	UTSW	13	19104345	missense	probably damaging	1.00
R4965:Amph	UTSW	13	19137699	missense	probably benign	0.12
R5777:Amph	UTSW	13	19046016	missense	probably damaging	1.00
R5787:Amph	UTSW	13	18948454	missense	possibly damaging	0.75
R6091:Amph	UTSW	13	19125123	missense	probably benign	0.01
R7100:Amph	UTSW	13	19149841	makesense	probably null
R7451:Amph	UTSW	13	19077368	missense	probably damaging	1.00
R7522:Amph	UTSW	13	19086545	missense	probably damaging	0.96
R8165:Amph	UTSW	13	19094837	missense	probably benign	0.05
R8166:Amph	UTSW	13	18948490	missense	possibly damaging	0.91
R8214:Amph	UTSW	13	19104298	missense	possibly damaging	0.81
R9021:Amph	UTSW	13	19099901	missense	probably benign	0.35
R9241:Amph	UTSW	13	19094802	missense	probably damaging	1.00
R9469:Amph	UTSW	13	19086599	missense	probably damaging	1.00
R9717:Amph	UTSW	13	19125083	missense	probably benign	0.07
R9755:Amph	UTSW	13	19113155	missense	probably damaging	1.00
V1662:Amph	UTSW	13	19139370	missense	probably benign	0.36
Z1177:Amph	UTSW	13	19139334	missense	possibly damaging	0.74

Predicted Primers

PCR Primer
(F):5'- CTCAGGTAATGCTAACTCAATAGTCCG -3'
(R):5'- CCTCTGCATTCCGTGAATGG -3'

Sequencing Primer
(F):5'- TGAGGTCCCAGTACTAGCT -3'
(R):5'- CTGCATTCCGTGAATGGTTAAGAAC -3'

Posted On

2019-05-15