Incidental Mutation 'R7103:Amph'
ID 551008
Institutional Source Beutler Lab
Gene Symbol Amph
Ensembl Gene ENSMUSG00000021314
Gene Name amphiphysin
Synonyms
MMRRC Submission 045195-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.278) question?
Stock # R7103 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 19132375-19335091 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 19333908 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 656 (D656E)
Ref Sequence ENSEMBL: ENSMUSP00000142766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003345] [ENSMUST00000200466]
AlphaFold Q7TQF7
Predicted Effect probably benign
Transcript: ENSMUST00000003345
AA Change: D652E

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000003345
Gene: ENSMUSG00000021314
AA Change: D652E

DomainStartEndE-ValueType
BAR 12 233 8.47e-80 SMART
low complexity region 260 277 N/A INTRINSIC
low complexity region 282 295 N/A INTRINSIC
low complexity region 301 315 N/A INTRINSIC
low complexity region 341 362 N/A INTRINSIC
low complexity region 424 445 N/A INTRINSIC
low complexity region 479 499 N/A INTRINSIC
SH3 616 686 7.82e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200466
AA Change: D656E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000142766
Gene: ENSMUSG00000021314
AA Change: D656E

DomainStartEndE-ValueType
BAR 12 233 2.3e-82 SMART
low complexity region 260 277 N/A INTRINSIC
low complexity region 282 295 N/A INTRINSIC
low complexity region 301 315 N/A INTRINSIC
low complexity region 341 362 N/A INTRINSIC
low complexity region 428 449 N/A INTRINSIC
low complexity region 483 503 N/A INTRINSIC
SH3 620 690 4.9e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein associated with the cytoplasmic surface of synaptic vesicles. A subset of patients with stiff-man syndrome who were also affected by breast cancer are positive for autoantibodies against this protein. Alternate splicing of this gene results in two transcript variants encoding different isoforms. Additional splice variants have been described, but their full length sequences have not been determined. A pseudogene of this gene is found on chromosome 11.[provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for a targeted mutation of this gene exhibit learning deficits and synaptic vesicle recycling defects, and die between 2 to 5 months of age from rare irreversible seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 A G 11: 50,628,181 (GRCm39) T294A probably damaging Het
Adamtsl2 G A 2: 26,997,473 (GRCm39) V893I probably damaging Het
Aoah T C 13: 21,207,485 (GRCm39) F568S probably damaging Het
Atr G A 9: 95,747,425 (GRCm39) G236S probably damaging Het
Brd3 T A 2: 27,340,406 (GRCm39) Q601L probably damaging Het
Ccar2 T C 14: 70,379,426 (GRCm39) E524G probably damaging Het
Cog2 T C 8: 125,267,853 (GRCm39) probably null Het
Csnka2ip C A 16: 64,299,120 (GRCm39) V415F unknown Het
Dmp1 A T 5: 104,359,729 (GRCm39) D135V probably damaging Het
Dtna T C 18: 23,786,436 (GRCm39) probably null Het
Endou A G 15: 97,616,810 (GRCm39) S238P probably damaging Het
Ep400 T A 5: 110,881,651 (GRCm39) E779D unknown Het
Fcgbp A G 7: 27,784,387 (GRCm39) E149G probably benign Het
G6pc1 C A 11: 101,265,413 (GRCm39) probably null Het
Gmeb1 T C 4: 131,962,179 (GRCm39) H160R probably damaging Het
Gramd1b T C 9: 40,312,902 (GRCm39) Y22C unknown Het
Hcrtr2 C T 9: 76,161,793 (GRCm39) G199D probably benign Het
Hoxb2 T C 11: 96,244,447 (GRCm39) F353L possibly damaging Het
Itpr2 C A 6: 146,226,572 (GRCm39) V1391F probably damaging Het
Jakmip2 T A 18: 43,673,648 (GRCm39) probably null Het
Kcnmb4 T C 10: 116,309,164 (GRCm39) Y88C possibly damaging Het
Kif1a T C 1: 93,005,507 (GRCm39) Y89C probably damaging Het
Kif23 T A 9: 61,827,174 (GRCm39) K892N probably damaging Het
Lama3 T A 18: 12,664,936 (GRCm39) S646T probably benign Het
Lig3 T A 11: 82,688,138 (GRCm39) M709K probably benign Het
Mindy3 C A 2: 12,405,885 (GRCm39) A137S possibly damaging Het
Mis18bp1 T C 12: 65,196,057 (GRCm39) E569G possibly damaging Het
Misp T A 10: 79,662,999 (GRCm39) L472Q probably damaging Het
Mrps5 A T 2: 127,443,330 (GRCm39) T303S probably damaging Het
Msh3 T G 13: 92,411,308 (GRCm39) I630L probably benign Het
Muc21 C A 17: 35,932,432 (GRCm39) A585S unknown Het
Myo16 A G 8: 10,619,673 (GRCm39) Y1408C unknown Het
N4bp2 T C 5: 65,964,189 (GRCm39) V746A probably benign Het
Oga G A 19: 45,771,605 (GRCm39) probably benign Het
Or4c120 A G 2: 89,000,827 (GRCm39) I243T possibly damaging Het
Or4d11 A G 19: 12,013,752 (GRCm39) M118T probably damaging Het
Or5p56 A G 7: 107,589,805 (GRCm39) T78A possibly damaging Het
Ostf1 C T 19: 18,573,715 (GRCm39) M44I probably null Het
Pik3c2b T G 1: 133,033,712 (GRCm39) L1572R probably damaging Het
Pilra T C 5: 137,829,488 (GRCm39) D192G possibly damaging Het
Pkhd1l1 A G 15: 44,437,027 (GRCm39) I3462V probably benign Het
Plekhh1 A G 12: 79,113,429 (GRCm39) D619G probably benign Het
Pramel31 C T 4: 144,090,297 (GRCm39) R446C probably benign Het
Ptprb T A 10: 116,174,718 (GRCm39) Y797N probably damaging Het
Rb1 T C 14: 73,500,084 (GRCm39) D521G probably damaging Het
Rnf17 T G 14: 56,708,763 (GRCm39) F728V possibly damaging Het
Slc16a4 T C 3: 107,218,787 (GRCm39) S463P probably damaging Het
Slc4a1 A T 11: 102,244,693 (GRCm39) I634K probably damaging Het
Slc4a1ap T C 5: 31,701,201 (GRCm39) V634A probably benign Het
Spam1 A G 6: 24,800,583 (GRCm39) M441V probably benign Het
Teddm3 A C 16: 20,971,729 (GRCm39) L280* probably null Het
Tmem231 T C 8: 112,645,517 (GRCm39) probably null Het
Tom1l1 T C 11: 90,561,907 (GRCm39) probably null Het
Topors C T 4: 40,261,706 (GRCm39) G526D probably benign Het
Trpm6 A T 19: 18,790,911 (GRCm39) I649F possibly damaging Het
Ttc16 T A 2: 32,664,440 (GRCm39) M66L probably benign Het
Tubgcp6 A G 15: 88,985,232 (GRCm39) F1619L probably damaging Het
Vps13d G T 4: 144,842,062 (GRCm39) A2619E Het
Vps8 G A 16: 21,345,191 (GRCm39) R838H probably damaging Het
Vwde T A 6: 13,215,799 (GRCm39) M86L probably benign Het
Zfp64 A T 2: 168,768,357 (GRCm39) D418E probably benign Het
Zfp952 C T 17: 33,222,606 (GRCm39) P362S possibly damaging Het
Zglp1 T C 9: 20,977,368 (GRCm39) E149G probably benign Het
Other mutations in Amph
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Amph APN 13 19,304,776 (GRCm39) missense probably damaging 1.00
IGL01866:Amph APN 13 19,326,172 (GRCm39) missense probably damaging 1.00
IGL02157:Amph APN 13 19,288,401 (GRCm39) missense possibly damaging 0.60
IGL02300:Amph APN 13 19,270,774 (GRCm39) missense probably damaging 1.00
IGL02435:Amph APN 13 19,323,333 (GRCm39) splice site probably benign
IGL03060:Amph APN 13 19,278,984 (GRCm39) missense probably damaging 0.99
IGL03122:Amph APN 13 19,287,113 (GRCm39) missense probably damaging 0.98
R0037:Amph UTSW 13 19,284,823 (GRCm39) missense possibly damaging 0.90
R0646:Amph UTSW 13 19,297,286 (GRCm39) missense possibly damaging 0.95
R0652:Amph UTSW 13 19,270,791 (GRCm39) splice site probably null
R1005:Amph UTSW 13 19,326,198 (GRCm39) missense probably damaging 0.97
R1006:Amph UTSW 13 19,326,198 (GRCm39) missense probably damaging 0.97
R1199:Amph UTSW 13 19,326,198 (GRCm39) missense probably damaging 0.97
R1200:Amph UTSW 13 19,326,198 (GRCm39) missense probably damaging 0.97
R1201:Amph UTSW 13 19,326,198 (GRCm39) missense probably damaging 0.97
R1333:Amph UTSW 13 19,326,198 (GRCm39) missense probably damaging 0.97
R1334:Amph UTSW 13 19,326,198 (GRCm39) missense probably damaging 0.97
R1335:Amph UTSW 13 19,326,198 (GRCm39) missense probably damaging 0.97
R1337:Amph UTSW 13 19,326,198 (GRCm39) missense probably damaging 0.97
R1338:Amph UTSW 13 19,326,198 (GRCm39) missense probably damaging 0.97
R1384:Amph UTSW 13 19,326,198 (GRCm39) missense probably damaging 0.97
R1397:Amph UTSW 13 19,326,198 (GRCm39) missense probably damaging 0.97
R1501:Amph UTSW 13 19,288,461 (GRCm39) nonsense probably null
R1528:Amph UTSW 13 19,326,198 (GRCm39) missense probably damaging 0.97
R1822:Amph UTSW 13 19,132,625 (GRCm39) missense probably damaging 0.98
R2004:Amph UTSW 13 19,326,198 (GRCm39) missense probably damaging 0.97
R2006:Amph UTSW 13 19,326,198 (GRCm39) missense probably damaging 0.97
R2061:Amph UTSW 13 19,309,205 (GRCm39) nonsense probably null
R2111:Amph UTSW 13 19,300,436 (GRCm39) splice site probably benign
R2329:Amph UTSW 13 19,323,520 (GRCm39) missense probably benign
R2878:Amph UTSW 13 19,288,437 (GRCm39) missense possibly damaging 0.95
R3121:Amph UTSW 13 19,297,316 (GRCm39) nonsense probably null
R3548:Amph UTSW 13 19,287,129 (GRCm39) missense probably damaging 1.00
R4059:Amph UTSW 13 19,326,168 (GRCm39) missense probably damaging 1.00
R4369:Amph UTSW 13 19,321,870 (GRCm39) missense probably benign 0.20
R4492:Amph UTSW 13 19,333,928 (GRCm39) missense possibly damaging 0.76
R4855:Amph UTSW 13 19,268,378 (GRCm39) missense probably damaging 1.00
R4937:Amph UTSW 13 19,288,515 (GRCm39) missense probably damaging 1.00
R4965:Amph UTSW 13 19,321,869 (GRCm39) missense probably benign 0.12
R5777:Amph UTSW 13 19,230,186 (GRCm39) missense probably damaging 1.00
R5787:Amph UTSW 13 19,132,624 (GRCm39) missense possibly damaging 0.75
R6091:Amph UTSW 13 19,309,293 (GRCm39) missense probably benign 0.01
R7100:Amph UTSW 13 19,334,011 (GRCm39) makesense probably null
R7451:Amph UTSW 13 19,261,538 (GRCm39) missense probably damaging 1.00
R7522:Amph UTSW 13 19,270,715 (GRCm39) missense probably damaging 0.96
R8165:Amph UTSW 13 19,279,007 (GRCm39) missense probably benign 0.05
R8166:Amph UTSW 13 19,132,660 (GRCm39) missense possibly damaging 0.91
R8214:Amph UTSW 13 19,288,468 (GRCm39) missense possibly damaging 0.81
R9021:Amph UTSW 13 19,284,071 (GRCm39) missense probably benign 0.35
R9241:Amph UTSW 13 19,278,972 (GRCm39) missense probably damaging 1.00
R9469:Amph UTSW 13 19,270,769 (GRCm39) missense probably damaging 1.00
R9717:Amph UTSW 13 19,309,253 (GRCm39) missense probably benign 0.07
R9755:Amph UTSW 13 19,297,325 (GRCm39) missense probably damaging 1.00
V1662:Amph UTSW 13 19,323,540 (GRCm39) missense probably benign 0.36
Z1177:Amph UTSW 13 19,323,504 (GRCm39) missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- CTCAGGTAATGCTAACTCAATAGTCCG -3'
(R):5'- CCTCTGCATTCCGTGAATGG -3'

Sequencing Primer
(F):5'- TGAGGTCCCAGTACTAGCT -3'
(R):5'- CTGCATTCCGTGAATGGTTAAGAAC -3'
Posted On 2019-05-15