Mutagenetix > Incidental Mutations

Incidental Mutation 'R0597:Sort1'

55101

Institutional Source

Beutler Lab

Gene Symbol

Sort1

Ensembl Gene

ENSMUSG00000068747

Gene Name

sortilin 1

Synonyms

sortilin, 2900053A11Rik, Ntsr3, Ntr3, neurotensin receptor 3

MMRRC Submission

038786-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.822) question?

Stock #

R0597 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

108284082-108361511 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 108338910 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 401 (D401G)

Ref Sequence

ENSEMBL: ENSMUSP00000123564 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102632] [ENSMUST00000135636]

Predicted Effect

probably damaging
Transcript: ENSMUST00000102632
AA Change: D401G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099692
Gene: ENSMUSG00000068747
AA Change: D401G

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
low complexity region	33	47	N/A	INTRINSIC
low complexity region	59	79	N/A	INTRINSIC
VPS10	131	743	N/A	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000135636
AA Change: D401G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000123564
Gene: ENSMUSG00000068747
AA Change: D401G

Domain	Start	End	E-Value	Type
VPS10	1	218	2.3e-5	SMART
transmembrane domain	262	284	N/A	INTRINSIC

Meta Mutation Damage Score

0.9428

Coding Region Coverage

1x: 99.6%
3x: 99.0%
10x: 97.4%
20x: 94.1%

Validation Efficiency

97% (71/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the VPS10-related sortilin family of proteins. The encoded preproprotein is proteolytically processed by furin to generate the mature receptor. This receptor plays a role in the trafficking of different proteins to either the cell surface, or subcellular compartments such as lysosomes and endosomes. Expression levels of this gene may influence the risk of myocardial infarction in human patients. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a null allele exhbit increased protection from age- and injury-related neuron lose. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy10	T	C	1: 165,525,062		probably null	Het
Anxa11	T	C	14: 25,874,228	I221T	probably damaging	Het
Arhgap33	C	G	7: 30,526,446	R565P	probably damaging	Het
Bmpr2	T	C	1: 59,841,425		probably benign	Het
Btn2a2	T	A	13: 23,486,410	H51L	probably benign	Het
Casz1	T	C	4: 148,944,394	S1099P	probably benign	Het
Cnot4	A	G	6: 35,051,503	S393P	possibly damaging	Het
Cntnap5a	T	C	1: 116,184,461		probably benign	Het
Cobl	T	C	11: 12,254,699	T586A	probably benign	Het
Crocc	A	G	4: 141,017,071	L1838P	probably benign	Het
Crocc	T	C	4: 141,019,913	K1528R	probably benign	Het
Dact2	A	G	17: 14,197,041	V299A	probably benign	Het
Dapk1	C	A	13: 60,761,384	N1270K	probably benign	Het
Ddx41	T	C	13: 55,533,006	Y375C	probably damaging	Het
Dock5	T	A	14: 67,784,934		probably null	Het
Dyrk4	T	G	6: 126,886,649		probably null	Het
Eno1b	T	C	18: 48,047,739	I328T	probably benign	Het
Fam210b	A	G	2: 172,345,853		probably benign	Het
Fbxl13	A	G	5: 21,614,714	I229T	probably benign	Het
Fbxo39	A	G	11: 72,316,921	D33G	probably damaging	Het
Fbxw11	A	G	11: 32,720,496	E120G	probably damaging	Het
Fbxw2	A	T	2: 34,811,020	L261Q	probably damaging	Het
Gm13084	G	T	4: 143,812,652	N90K	probably damaging	Het
Gm5800	A	C	14: 51,716,004	N51K	probably benign	Het
Gm6899	A	G	11: 26,593,768		probably benign	Het
Gm9745	C	A	13: 8,940,766		probably benign	Het
Gpx8	T	C	13: 113,045,501	T133A	possibly damaging	Het
Grin3a	C	T	4: 49,665,351	V1095M	probably damaging	Het
Grip2	T	C	6: 91,796,197		probably benign	Het
Hacd4	A	G	4: 88,437,520	F43L	probably damaging	Het
Hif1a	T	G	12: 73,942,275	S645R	probably benign	Het
Hipk3	A	G	2: 104,433,637	S839P	possibly damaging	Het
Il16	A	T	7: 83,677,975		probably benign	Het
Il3ra	T	A	14: 14,351,166		probably null	Het
Il5ra	A	G	6: 106,744,335	M1T	probably null	Het
Klra2	G	A	6: 131,220,185	R251C	probably benign	Het
Lamc2	C	T	1: 153,133,621	V813M	probably benign	Het
Lbr	A	G	1: 181,832,213	V139A	probably benign	Het
Lrp5	T	C	19: 3,600,777	D1219G	possibly damaging	Het
Map3k6	C	T	4: 133,245,552	P341S	possibly damaging	Het
Mcts2	A	G	2: 152,687,689	E140G	probably benign	Het
Med1	T	C	11: 98,169,438	M222V	probably benign	Het
Mef2a	G	T	7: 67,235,148	S406*	probably null	Het
Muc19	A	T	15: 91,900,502		noncoding transcript	Het
Nr1h2	A	G	7: 44,552,260		probably benign	Het
Olfr1361	C	A	13: 21,659,146	R59L	probably damaging	Het
Olfr205	A	T	16: 59,328,760	F250I	probably damaging	Het
Olfr682-ps1	A	G	7: 105,128,218	V73A	possibly damaging	Het
Olfr71	A	T	4: 43,706,592		probably null	Het
P4hb	G	A	11: 120,568,244	T141I	possibly damaging	Het
Polr3a	A	G	14: 24,484,134	V101A	probably benign	Het
Pou4f2	A	G	8: 78,435,240	S245P	probably benign	Het
Rnpep	A	G	1: 135,272,419	V266A	probably damaging	Het
Scly	G	A	1: 91,309,833	G206R	probably damaging	Het
Sec14l3	A	T	11: 4,074,814	K254N	probably damaging	Het
Sgpp1	A	T	12: 75,735,100	I155N	probably damaging	Het
Slc22a14	A	G	9: 119,172,124	L468P	probably damaging	Het
Slc22a27	A	G	19: 7,865,884	F377L	probably benign	Het
Slc44a3	T	C	3: 121,460,070	I625V	probably benign	Het
Slc47a2	A	T	11: 61,309,976	I373N	probably damaging	Het
Slfn10-ps	A	T	11: 83,035,653		noncoding transcript	Het
Smarcd1	T	A	15: 99,711,094	I383N	probably damaging	Het
Sprr2a3	G	T	3: 92,288,590	M1I	probably null	Het
Sycp2	A	C	2: 178,356,580	V1049G	possibly damaging	Het
Tecrl	T	A	5: 83,354,928	K10*	probably null	Het
Tnpo3	A	T	6: 29,578,565	C303*	probably null	Het
Vmn2r23	A	G	6: 123,729,721	I503M	probably benign	Het
Zbtb8os	T	A	4: 129,346,877	I164N	probably damaging	Het
Zfp292	T	C	4: 34,807,399	N1882D	probably benign	Het
Zfp91	T	C	19: 12,770,095	I555V	possibly damaging	Het

Other mutations in Sort1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00227:Sort1	APN	3	108356307	missense	probably damaging	0.99
IGL01677:Sort1	APN	3	108344885	missense	probably benign	0.05
IGL02532:Sort1	APN	3	108325720	missense	probably benign	0.44
IGL03354:Sort1	APN	3	108348706	missense	probably benign	0.00
R0266:Sort1	UTSW	3	108344931	missense	probably benign	0.09
R0277:Sort1	UTSW	3	108324592	splice site	probably benign
R0559:Sort1	UTSW	3	108356579	missense	probably damaging	1.00
R0624:Sort1	UTSW	3	108348630	missense	probably damaging	1.00
R1803:Sort1	UTSW	3	108325699	missense	probably damaging	1.00
R1872:Sort1	UTSW	3	108340695	missense	probably benign	0.01
R1986:Sort1	UTSW	3	108345727	missense	possibly damaging	0.71
R2130:Sort1	UTSW	3	108351686	missense	probably benign
R2131:Sort1	UTSW	3	108351686	missense	probably benign
R2133:Sort1	UTSW	3	108351686	missense	probably benign
R2362:Sort1	UTSW	3	108346665	missense	possibly damaging	0.89
R3436:Sort1	UTSW	3	108337807	missense	probably damaging	1.00
R3548:Sort1	UTSW	3	108337909	missense	possibly damaging	0.83
R3700:Sort1	UTSW	3	108356639	nonsense	probably null
R4496:Sort1	UTSW	3	108310145	missense	probably benign	0.17
R4616:Sort1	UTSW	3	108355541	missense	possibly damaging	0.66
R4632:Sort1	UTSW	3	108346678	missense	probably damaging	1.00
R4749:Sort1	UTSW	3	108356323	nonsense	probably null
R4994:Sort1	UTSW	3	108328069	missense	probably damaging	0.99
R5187:Sort1	UTSW	3	108324676	missense	probably damaging	1.00
R5753:Sort1	UTSW	3	108345774	missense	probably damaging	1.00
R6019:Sort1	UTSW	3	108357233	missense	possibly damaging	0.77
R6262:Sort1	UTSW	3	108310211	missense	probably damaging	1.00
R7369:Sort1	UTSW	3	108351680	missense	probably damaging	1.00
R7484:Sort1	UTSW	3	108338825	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAAGGCGATTAAACAGATGTGCCG -3'
(R):5'- CAAGTTCAGGTTCAGTCCGCTAGG -3'

Sequencing Primer
(F):5'- ACAGATGTGCCGGGCTATG -3'
(R):5'- TTGCACACCGGCCAATATG -3'

Posted On

2013-07-11