Incidental Mutation 'R7103:Msh3'
ID551010
Institutional Source Beutler Lab
Gene Symbol Msh3
Ensembl Gene ENSMUSG00000014850
Gene NamemutS homolog 3
SynonymsRep3, Rep-3, D13Em1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.287) question?
Stock #R7103 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location92211872-92355003 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 92274800 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 630 (I630L)
Ref Sequence ENSEMBL: ENSMUSP00000140002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022220] [ENSMUST00000185852] [ENSMUST00000187874] [ENSMUST00000191550]
Predicted Effect
SMART Domains Protein: ENSMUSP00000022220
Gene: ENSMUSG00000014850
AA Change: I630L

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:MutS_I 188 301 1.6e-35 PFAM
Pfam:MutS_II 324 481 2.2e-36 PFAM
MUTSd 513 828 7.62e-97 SMART
MUTSac 847 1049 9.7e-122 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185852
AA Change: I630L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140002
Gene: ENSMUSG00000014850
AA Change: I630L

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:MutS_I 188 301 7.2e-35 PFAM
Pfam:MutS_II 324 481 2.2e-36 PFAM
MUTSd 513 828 7.62e-97 SMART
MUTSac 847 1049 9.7e-122 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187874
SMART Domains Protein: ENSMUSP00000139620
Gene: ENSMUSG00000014850

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191550
SMART Domains Protein: ENSMUSP00000140659
Gene: ENSMUSG00000014850

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a heterodimer with MSH2 to form MutS beta, part of the post-replicative DNA mismatch repair system. MutS beta initiates mismatch repair by binding to a mismatch and then forming a complex with MutL alpha heterodimer. This gene contains a polymorphic 9 bp tandem repeat sequence in the first exon. The repeat is present 6 times in the reference genome sequence and 3-7 repeats have been reported. Defects in this gene are a cause of susceptibility to endometrial cancer. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a partial defect mismatch repair and development of intestinal tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 A G 11: 50,737,354 T294A probably damaging Het
Adamtsl2 G A 2: 27,107,461 V893I probably damaging Het
Amph T A 13: 19,149,738 D656E probably benign Het
Aoah T C 13: 21,023,315 F568S probably damaging Het
Atr G A 9: 95,865,372 G236S probably damaging Het
Brd3 T A 2: 27,450,394 Q601L probably damaging Het
Ccar2 T C 14: 70,141,977 E524G probably damaging Het
Cog2 T C 8: 124,541,114 probably null Het
Csnka2ip C A 16: 64,478,757 V415F unknown Het
Dmp1 A T 5: 104,211,863 D135V probably damaging Het
Dtna T C 18: 23,653,379 probably null Het
Endou A G 15: 97,718,929 S238P probably damaging Het
Ep400 T A 5: 110,733,785 E779D unknown Het
Fcgbp A G 7: 28,084,962 E149G probably benign Het
G6pc C A 11: 101,374,587 probably null Het
Gm13119 C T 4: 144,363,727 R446C probably benign Het
Gm9573 C A 17: 35,621,540 A585S unknown Het
Gmeb1 T C 4: 132,234,868 H160R probably damaging Het
Gramd1b T C 9: 40,401,606 Y22C unknown Het
Hcrtr2 C T 9: 76,254,511 G199D probably benign Het
Hoxb2 T C 11: 96,353,621 F353L possibly damaging Het
Itpr2 C A 6: 146,325,074 V1391F probably damaging Het
Jakmip2 T A 18: 43,540,583 probably null Het
Kcnmb4 T C 10: 116,473,259 Y88C possibly damaging Het
Kif1a T C 1: 93,077,785 Y89C probably damaging Het
Kif23 T A 9: 61,919,892 K892N probably damaging Het
Lama3 T A 18: 12,531,879 S646T probably benign Het
Lig3 T A 11: 82,797,312 M709K probably benign Het
Mgea5 G A 19: 45,783,166 probably benign Het
Mindy3 C A 2: 12,401,074 A137S possibly damaging Het
Mis18bp1 T C 12: 65,149,283 E569G possibly damaging Het
Misp T A 10: 79,827,165 L472Q probably damaging Het
Mrps5 A T 2: 127,601,410 T303S probably damaging Het
Myo16 A G 8: 10,569,673 Y1408C unknown Het
N4bp2 T C 5: 65,806,846 V746A probably benign Het
Olfr1225 A G 2: 89,170,483 I243T possibly damaging Het
Olfr1423 A G 19: 12,036,388 M118T probably damaging Het
Olfr477 A G 7: 107,990,598 T78A possibly damaging Het
Ostf1 C T 19: 18,596,351 M44I probably null Het
Pik3c2b T G 1: 133,105,974 L1572R probably damaging Het
Pilra T C 5: 137,831,226 D192G possibly damaging Het
Pkhd1l1 A G 15: 44,573,631 I3462V probably benign Het
Plekhh1 A G 12: 79,066,655 D619G probably benign Het
Ptprb T A 10: 116,338,813 Y797N probably damaging Het
Rb1 T C 14: 73,262,644 D521G probably damaging Het
Rnf17 T G 14: 56,471,306 F728V possibly damaging Het
Slc16a4 T C 3: 107,311,471 S463P probably damaging Het
Slc4a1 A T 11: 102,353,867 I634K probably damaging Het
Slc4a1ap T C 5: 31,543,857 V634A probably benign Het
Spam1 A G 6: 24,800,584 M441V probably benign Het
Teddm3 A C 16: 21,152,979 L280* probably null Het
Tmem231 T C 8: 111,918,885 probably null Het
Tom1l1 T C 11: 90,671,081 probably null Het
Topors C T 4: 40,261,706 G526D probably benign Het
Trpm6 A T 19: 18,813,547 I649F possibly damaging Het
Ttc16 T A 2: 32,774,428 M66L probably benign Het
Tubgcp6 A G 15: 89,101,029 F1619L probably damaging Het
Vps13d G T 4: 145,115,492 A2619E Het
Vps8 G A 16: 21,526,441 R838H probably damaging Het
Vwde T A 6: 13,215,800 M86L probably benign Het
Zfp64 A T 2: 168,926,437 D418E probably benign Het
Zfp952 C T 17: 33,003,632 P362S possibly damaging Het
Zglp1 T C 9: 21,066,072 E149G probably benign Het
Other mutations in Msh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Msh3 APN 13 92344964 missense probably damaging 1.00
IGL00983:Msh3 APN 13 92300277 missense probably damaging 1.00
IGL01490:Msh3 APN 13 92300305 missense probably damaging 1.00
IGL02072:Msh3 APN 13 92300295 missense probably damaging 1.00
IGL02313:Msh3 APN 13 92349312 missense possibly damaging 0.86
IGL02711:Msh3 APN 13 92351311 missense probably damaging 1.00
IGL03108:Msh3 APN 13 92221088 splice site probably benign
IGL03227:Msh3 APN 13 92285960 missense probably damaging 0.98
R0164:Msh3 UTSW 13 92349209 missense probably damaging 1.00
R0164:Msh3 UTSW 13 92349209 missense probably damaging 1.00
R0415:Msh3 UTSW 13 92346786 missense possibly damaging 0.89
R0457:Msh3 UTSW 13 92220997 missense probably damaging 1.00
R0659:Msh3 UTSW 13 92345096 missense possibly damaging 0.80
R0661:Msh3 UTSW 13 92345096 missense possibly damaging 0.80
R0686:Msh3 UTSW 13 92351431 missense possibly damaging 0.53
R0688:Msh3 UTSW 13 92351431 missense possibly damaging 0.53
R0707:Msh3 UTSW 13 92347340 nonsense probably null
R1605:Msh3 UTSW 13 92300275 missense probably null 1.00
R1622:Msh3 UTSW 13 92344954 critical splice donor site probably null
R1771:Msh3 UTSW 13 92212496 missense probably benign 0.05
R1970:Msh3 UTSW 13 92249820 splice site probably benign
R1971:Msh3 UTSW 13 92223276 missense probably damaging 1.00
R1971:Msh3 UTSW 13 92249820 splice site probably benign
R2894:Msh3 UTSW 13 92342360 missense probably benign 0.16
R3837:Msh3 UTSW 13 92354858 missense probably damaging 1.00
R4119:Msh3 UTSW 13 92354011 intron probably benign
R4225:Msh3 UTSW 13 92285923 missense probably benign 0.03
R4881:Msh3 UTSW 13 92266041 intron probably benign
R5118:Msh3 UTSW 13 92309434 splice site probably benign
R5209:Msh3 UTSW 13 92344954 critical splice donor site probably null
R5817:Msh3 UTSW 13 92286000 missense possibly damaging 0.86
R5849:Msh3 UTSW 13 92249878 missense possibly damaging 0.81
R5851:Msh3 UTSW 13 92215522 missense probably benign 0.00
R5940:Msh3 UTSW 13 92249843 missense probably damaging 1.00
R6004:Msh3 UTSW 13 92342414 critical splice acceptor site probably null
R6363:Msh3 UTSW 13 92212524 missense probably damaging 1.00
R6510:Msh3 UTSW 13 92353264 nonsense probably null
R6654:Msh3 UTSW 13 92345042 missense probably benign 0.01
R6853:Msh3 UTSW 13 92312572 critical splice donor site probably null
R7022:Msh3 UTSW 13 92235588 missense probably damaging 1.00
R7098:Msh3 UTSW 13 92274111 missense possibly damaging 0.95
R7148:Msh3 UTSW 13 92354822 missense probably benign 0.18
R7171:Msh3 UTSW 13 92349298 missense probably benign 0.00
R7317:Msh3 UTSW 13 92286004 missense probably damaging 1.00
R7369:Msh3 UTSW 13 92299262 missense probably benign 0.15
R7586:Msh3 UTSW 13 92349332 utr 3 prime probably benign
R7641:Msh3 UTSW 13 92212503 missense probably benign 0.08
R7648:Msh3 UTSW 13 92274028 missense probably damaging 1.00
R7674:Msh3 UTSW 13 92212503 missense probably benign 0.08
R8125:Msh3 UTSW 13 92299182 missense probably benign
S24628:Msh3 UTSW 13 92346786 missense possibly damaging 0.89
X0027:Msh3 UTSW 13 92274070 missense probably damaging 0.98
X0063:Msh3 UTSW 13 92274785 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCCAGACTGTCAACTATGTG -3'
(R):5'- GGTTCTTTACTGCACCCTGG -3'

Sequencing Primer
(F):5'- GACTGTCAACTATGTGCGTTTAAAC -3'
(R):5'- TGATCTTGAACTTGCAGAGACCC -3'
Posted On2019-05-15