Mutagenetix > Incidental Mutation

Incidental Mutation 'R7103:Rb1'

551013

Institutional Source

Beutler Lab

Gene Symbol

Rb1

Ensembl Gene

ENSMUSG00000022105

Gene Name

RB transcriptional corepressor 1

Synonyms

Rb-1, Rb, pRb

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7103 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

73183673-73325822 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 73262644 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 521 (D521G)

Ref Sequence

ENSEMBL: ENSMUSP00000022701 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022701]

AlphaFold

P13405

Predicted Effect

probably damaging
Transcript: ENSMUST00000022701
AA Change: D521G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000022701
Gene: ENSMUSG00000022105
AA Change: D521G

Domain	Start	End	E-Value	Type
low complexity region	2	28	N/A	INTRINSIC
low complexity region	37	53	N/A	INTRINSIC
DUF3452	97	223	4.59e-25	SMART
RB_A	367	567	5.53e-92	SMART
CYCLIN	653	740	1.62e-5	SMART
Rb_C	761	920	1.28e-96	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

98% (61/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a negative regulator of the cell cycle and was the first tumor suppressor gene found. The encoded protein also stabilizes constitutive heterochromatin to maintain the overall chromatin structure. The active, hypophosphorylated form of the protein binds transcription factor E2F1. Defects in this gene are a cause of childhood cancer retinoblastoma (RB), bladder cancer, and osteogenic sarcoma. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted mutations exhibit abnormalities of the neuronal and hematopoietic systems and die in utero. Heterozygotes may develop pituitary tumors associated with loss of the normal allele. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts2	A	G	11: 50,737,354	T294A	probably damaging	Het
Adamtsl2	G	A	2: 27,107,461	V893I	probably damaging	Het
Amph	T	A	13: 19,149,738	D656E	probably benign	Het
Aoah	T	C	13: 21,023,315	F568S	probably damaging	Het
Atr	G	A	9: 95,865,372	G236S	probably damaging	Het
Brd3	T	A	2: 27,450,394	Q601L	probably damaging	Het
Ccar2	T	C	14: 70,141,977	E524G	probably damaging	Het
Cog2	T	C	8: 124,541,114		probably null	Het
Csnka2ip	C	A	16: 64,478,757	V415F	unknown	Het
Dmp1	A	T	5: 104,211,863	D135V	probably damaging	Het
Dtna	T	C	18: 23,653,379		probably null	Het
Endou	A	G	15: 97,718,929	S238P	probably damaging	Het
Ep400	T	A	5: 110,733,785	E779D	unknown	Het
Fcgbp	A	G	7: 28,084,962	E149G	probably benign	Het
G6pc	C	A	11: 101,374,587		probably null	Het
Gm13119	C	T	4: 144,363,727	R446C	probably benign	Het
Gm9573	C	A	17: 35,621,540	A585S	unknown	Het
Gmeb1	T	C	4: 132,234,868	H160R	probably damaging	Het
Gramd1b	T	C	9: 40,401,606	Y22C	unknown	Het
Hcrtr2	C	T	9: 76,254,511	G199D	probably benign	Het
Hoxb2	T	C	11: 96,353,621	F353L	possibly damaging	Het
Itpr2	C	A	6: 146,325,074	V1391F	probably damaging	Het
Jakmip2	T	A	18: 43,540,583		probably null	Het
Kcnmb4	T	C	10: 116,473,259	Y88C	possibly damaging	Het
Kif1a	T	C	1: 93,077,785	Y89C	probably damaging	Het
Kif23	T	A	9: 61,919,892	K892N	probably damaging	Het
Lama3	T	A	18: 12,531,879	S646T	probably benign	Het
Lig3	T	A	11: 82,797,312	M709K	probably benign	Het
Mgea5	G	A	19: 45,783,166		probably benign	Het
Mindy3	C	A	2: 12,401,074	A137S	possibly damaging	Het
Mis18bp1	T	C	12: 65,149,283	E569G	possibly damaging	Het
Misp	T	A	10: 79,827,165	L472Q	probably damaging	Het
Mrps5	A	T	2: 127,601,410	T303S	probably damaging	Het
Msh3	T	G	13: 92,274,800	I630L	probably benign	Het
Myo16	A	G	8: 10,569,673	Y1408C	unknown	Het
N4bp2	T	C	5: 65,806,846	V746A	probably benign	Het
Olfr1225	A	G	2: 89,170,483	I243T	possibly damaging	Het
Olfr1423	A	G	19: 12,036,388	M118T	probably damaging	Het
Olfr477	A	G	7: 107,990,598	T78A	possibly damaging	Het
Ostf1	C	T	19: 18,596,351	M44I	probably null	Het
Pik3c2b	T	G	1: 133,105,974	L1572R	probably damaging	Het
Pilra	T	C	5: 137,831,226	D192G	possibly damaging	Het
Pkhd1l1	A	G	15: 44,573,631	I3462V	probably benign	Het
Plekhh1	A	G	12: 79,066,655	D619G	probably benign	Het
Ptprb	T	A	10: 116,338,813	Y797N	probably damaging	Het
Rnf17	T	G	14: 56,471,306	F728V	possibly damaging	Het
Slc16a4	T	C	3: 107,311,471	S463P	probably damaging	Het
Slc4a1	A	T	11: 102,353,867	I634K	probably damaging	Het
Slc4a1ap	T	C	5: 31,543,857	V634A	probably benign	Het
Spam1	A	G	6: 24,800,584	M441V	probably benign	Het
Teddm3	A	C	16: 21,152,979	L280*	probably null	Het
Tmem231	T	C	8: 111,918,885		probably null	Het
Tom1l1	T	C	11: 90,671,081		probably null	Het
Topors	C	T	4: 40,261,706	G526D	probably benign	Het
Trpm6	A	T	19: 18,813,547	I649F	possibly damaging	Het
Ttc16	T	A	2: 32,774,428	M66L	probably benign	Het
Tubgcp6	A	G	15: 89,101,029	F1619L	probably damaging	Het
Vps13d	G	T	4: 145,115,492	A2619E		Het
Vps8	G	A	16: 21,526,441	R838H	probably damaging	Het
Vwde	T	A	6: 13,215,800	M86L	probably benign	Het
Zfp64	A	T	2: 168,926,437	D418E	probably benign	Het
Zfp952	C	T	17: 33,003,632	P362S	possibly damaging	Het
Zglp1	T	C	9: 21,066,072	E149G	probably benign	Het

Other mutations in Rb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00497:Rb1	APN	14	73264598	missense	probably damaging	1.00
IGL00951:Rb1	APN	14	73322072	missense	probably damaging	1.00
IGL01152:Rb1	APN	14	73205870	missense	probably damaging	1.00
IGL01339:Rb1	APN	14	73264371	critical splice acceptor site	probably null
IGL01349:Rb1	APN	14	73269118	missense	probably damaging	1.00
IGL01390:Rb1	APN	14	73294999	missense	probably benign	0.02
IGL02066:Rb1	APN	14	73198534	missense	probably benign	0.06
IGL02207:Rb1	APN	14	73206085	missense	probably damaging	1.00
IGL02860:Rb1	APN	14	73206012	missense	probably damaging	1.00
IGL03370:Rb1	APN	14	73282866	critical splice donor site	probably null
rubidium	UTSW	14	73199311	missense	probably damaging	1.00
P0028:Rb1	UTSW	14	73264628	missense	probably damaging	1.00
R0553:Rb1	UTSW	14	73211712	nonsense	probably null
R0563:Rb1	UTSW	14	73216767	missense	probably damaging	1.00
R0586:Rb1	UTSW	14	73287684	intron	probably benign
R0595:Rb1	UTSW	14	73273680	missense	probably damaging	1.00
R0755:Rb1	UTSW	14	73197213	makesense	probably null
R1480:Rb1	UTSW	14	73262602	missense	probably benign
R1513:Rb1	UTSW	14	73322084	missense	probably benign	0.00
R1752:Rb1	UTSW	14	73287624	missense	probably damaging	0.99
R1919:Rb1	UTSW	14	73212990	nonsense	probably null
R2010:Rb1	UTSW	14	73294993	missense	probably benign	0.16
R2087:Rb1	UTSW	14	73280252	missense	probably benign	0.09
R2152:Rb1	UTSW	14	73288725	missense	probably benign
R2167:Rb1	UTSW	14	73211651	missense	probably damaging	1.00
R3950:Rb1	UTSW	14	73262662	missense	probably damaging	1.00
R4183:Rb1	UTSW	14	73198526	splice site	probably null
R4225:Rb1	UTSW	14	73269191	missense	possibly damaging	0.58
R4306:Rb1	UTSW	14	73262695	missense	probably damaging	1.00
R4464:Rb1	UTSW	14	73199198	splice site	probably null
R4609:Rb1	UTSW	14	73262514	splice site	probably benign
R4671:Rb1	UTSW	14	73273676	missense	probably damaging	1.00
R4916:Rb1	UTSW	14	73216691	missense	probably damaging	1.00
R5160:Rb1	UTSW	14	73264455	synonymous	silent
R5210:Rb1	UTSW	14	73199311	missense	probably damaging	1.00
R5320:Rb1	UTSW	14	73213126	nonsense	probably null
R5436:Rb1	UTSW	14	73213140	splice site	probably null
R5467:Rb1	UTSW	14	73211620	missense	possibly damaging	0.92
R5592:Rb1	UTSW	14	73211747	missense	probably damaging	1.00
R6326:Rb1	UTSW	14	73198534	missense	probably benign	0.06
R6363:Rb1	UTSW	14	73287641	missense	probably benign	0.01
R6395:Rb1	UTSW	14	73199196	missense	probably damaging	1.00
R6414:Rb1	UTSW	14	73282974	missense	unknown
R6460:Rb1	UTSW	14	73278454	missense	probably benign	0.06
R6503:Rb1	UTSW	14	73205880	missense	probably benign	0.08
R6519:Rb1	UTSW	14	73298063	missense	probably benign	0.00
R6671:Rb1	UTSW	14	73197266	missense	probably damaging	1.00
R7026:Rb1	UTSW	14	73298099	missense	probably benign	0.00
R7263:Rb1	UTSW	14	73282923	nonsense	probably null
R7478:Rb1	UTSW	14	73269137	missense	probably damaging	1.00
R7519:Rb1	UTSW	14	73264608	missense	probably damaging	1.00
R7817:Rb1	UTSW	14	73198543	missense	probably damaging	1.00
R8323:Rb1	UTSW	14	73265583	missense	probably benign	0.09
R8809:Rb1	UTSW	14	73265560	missense	probably damaging	1.00
R8813:Rb1	UTSW	14	73262587	missense	probably damaging	0.96
R8849:Rb1	UTSW	14	73197269	missense	probably damaging	1.00
R9272:Rb1	UTSW	14	73280162	missense	possibly damaging	0.85
R9482:Rb1	UTSW	14	73206053	missense	probably damaging	1.00
R9606:Rb1	UTSW	14	73280133	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TCGCTAACAGGTCACTTACG -3'
(R):5'- GTTTCTTGAGAGTCTGTAGACCAC -3'

Sequencing Primer
(F):5'- ACTTACGCATGAATACCTTCGG -3'
(R):5'- CCTGCTGTAAATAAAAAGTGCTTACC -3'

Posted On

2019-05-15