Mutagenetix > Incidental Mutation

Incidental Mutation 'R7103:Tubgcp6'

551015

Institutional Source

Beutler Lab

Gene Symbol

Tubgcp6

Ensembl Gene

ENSMUSG00000051786

Gene Name

tubulin, gamma complex associated protein 6

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.964) question?

Stock #

R7103 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

89098357-89123112 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 89101029 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 1619 (F1619L)

Ref Sequence

ENSEMBL: ENSMUSP00000104977 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041656] [ENSMUST00000082439] [ENSMUST00000109353] [ENSMUST00000130700] [ENSMUST00000166480]

AlphaFold

G5E8P0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000041656
AA Change: F1611L

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000040132
Gene: ENSMUSG00000051786
AA Change: F1611L

Domain	Start	End	E-Value	Type
Pfam:Spc97_Spc98	355	1667	3.3e-119	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000082439

SMART Domains

Protein: ENSMUSP00000081020
Gene: ENSMUSG00000035757

Domain	Start	End	E-Value	Type
low complexity region	24	38	N/A	INTRINSIC
Pfam:UPF0061	79	625	8.3e-131	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000109353
AA Change: F1619L

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000104977
Gene: ENSMUSG00000051786
AA Change: F1619L

Domain	Start	End	E-Value	Type
Pfam:Spc97_Spc98	355	1675	2.8e-94	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000130700

SMART Domains

Protein: ENSMUSP00000138382
Gene: ENSMUSG00000035757

Domain	Start	End	E-Value	Type
low complexity region	24	38	N/A	INTRINSIC
Pfam:UPF0061	80	241	1.5e-39	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000163290
AA Change: V290A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000131359
Gene: ENSMUSG00000051786
AA Change: V290A

Domain	Start	End	E-Value	Type
Pfam:Spc97_Spc98	91	288	2.9e-37	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000166480

SMART Domains

Protein: ENSMUSP00000132108
Gene: ENSMUSG00000051786

Domain	Start	End	E-Value	Type
Pfam:Spc97_Spc98	2	123	5e-18	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000169069

SMART Domains

Protein: ENSMUSP00000132786
Gene: ENSMUSG00000051786

Domain	Start	End	E-Value	Type
coiled coil region	77	107	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000170877

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

98% (61/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a large multisubunit complex required for microtubule nucleation at the centrosome. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts2	A	G	11: 50,737,354	T294A	probably damaging	Het
Adamtsl2	G	A	2: 27,107,461	V893I	probably damaging	Het
Amph	T	A	13: 19,149,738	D656E	probably benign	Het
Aoah	T	C	13: 21,023,315	F568S	probably damaging	Het
Atr	G	A	9: 95,865,372	G236S	probably damaging	Het
Brd3	T	A	2: 27,450,394	Q601L	probably damaging	Het
Ccar2	T	C	14: 70,141,977	E524G	probably damaging	Het
Cog2	T	C	8: 124,541,114		probably null	Het
Csnka2ip	C	A	16: 64,478,757	V415F	unknown	Het
Dmp1	A	T	5: 104,211,863	D135V	probably damaging	Het
Dtna	T	C	18: 23,653,379		probably null	Het
Endou	A	G	15: 97,718,929	S238P	probably damaging	Het
Ep400	T	A	5: 110,733,785	E779D	unknown	Het
Fcgbp	A	G	7: 28,084,962	E149G	probably benign	Het
G6pc	C	A	11: 101,374,587		probably null	Het
Gm13119	C	T	4: 144,363,727	R446C	probably benign	Het
Gm9573	C	A	17: 35,621,540	A585S	unknown	Het
Gmeb1	T	C	4: 132,234,868	H160R	probably damaging	Het
Gramd1b	T	C	9: 40,401,606	Y22C	unknown	Het
Hcrtr2	C	T	9: 76,254,511	G199D	probably benign	Het
Hoxb2	T	C	11: 96,353,621	F353L	possibly damaging	Het
Itpr2	C	A	6: 146,325,074	V1391F	probably damaging	Het
Jakmip2	T	A	18: 43,540,583		probably null	Het
Kcnmb4	T	C	10: 116,473,259	Y88C	possibly damaging	Het
Kif1a	T	C	1: 93,077,785	Y89C	probably damaging	Het
Kif23	T	A	9: 61,919,892	K892N	probably damaging	Het
Lama3	T	A	18: 12,531,879	S646T	probably benign	Het
Lig3	T	A	11: 82,797,312	M709K	probably benign	Het
Mgea5	G	A	19: 45,783,166		probably benign	Het
Mindy3	C	A	2: 12,401,074	A137S	possibly damaging	Het
Mis18bp1	T	C	12: 65,149,283	E569G	possibly damaging	Het
Misp	T	A	10: 79,827,165	L472Q	probably damaging	Het
Mrps5	A	T	2: 127,601,410	T303S	probably damaging	Het
Msh3	T	G	13: 92,274,800	I630L	probably benign	Het
Myo16	A	G	8: 10,569,673	Y1408C	unknown	Het
N4bp2	T	C	5: 65,806,846	V746A	probably benign	Het
Olfr1225	A	G	2: 89,170,483	I243T	possibly damaging	Het
Olfr1423	A	G	19: 12,036,388	M118T	probably damaging	Het
Olfr477	A	G	7: 107,990,598	T78A	possibly damaging	Het
Ostf1	C	T	19: 18,596,351	M44I	probably null	Het
Pik3c2b	T	G	1: 133,105,974	L1572R	probably damaging	Het
Pilra	T	C	5: 137,831,226	D192G	possibly damaging	Het
Pkhd1l1	A	G	15: 44,573,631	I3462V	probably benign	Het
Plekhh1	A	G	12: 79,066,655	D619G	probably benign	Het
Ptprb	T	A	10: 116,338,813	Y797N	probably damaging	Het
Rb1	T	C	14: 73,262,644	D521G	probably damaging	Het
Rnf17	T	G	14: 56,471,306	F728V	possibly damaging	Het
Slc16a4	T	C	3: 107,311,471	S463P	probably damaging	Het
Slc4a1	A	T	11: 102,353,867	I634K	probably damaging	Het
Slc4a1ap	T	C	5: 31,543,857	V634A	probably benign	Het
Spam1	A	G	6: 24,800,584	M441V	probably benign	Het
Teddm3	A	C	16: 21,152,979	L280*	probably null	Het
Tmem231	T	C	8: 111,918,885		probably null	Het
Tom1l1	T	C	11: 90,671,081		probably null	Het
Topors	C	T	4: 40,261,706	G526D	probably benign	Het
Trpm6	A	T	19: 18,813,547	I649F	possibly damaging	Het
Ttc16	T	A	2: 32,774,428	M66L	probably benign	Het
Vps13d	G	T	4: 145,115,492	A2619E		Het
Vps8	G	A	16: 21,526,441	R838H	probably damaging	Het
Vwde	T	A	6: 13,215,800	M86L	probably benign	Het
Zfp64	A	T	2: 168,926,437	D418E	probably benign	Het
Zfp952	C	T	17: 33,003,632	P362S	possibly damaging	Het
Zglp1	T	C	9: 21,066,072	E149G	probably benign	Het

Other mutations in Tubgcp6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00417:Tubgcp6	APN	15	89104008	missense	probably benign	0.00
IGL00556:Tubgcp6	APN	15	89100962	missense	probably damaging	1.00
IGL00943:Tubgcp6	APN	15	89122397	nonsense	probably null
IGL01284:Tubgcp6	APN	15	89110055	missense	probably damaging	1.00
IGL01363:Tubgcp6	APN	15	89107525	missense	probably damaging	1.00
IGL01386:Tubgcp6	APN	15	89107996	nonsense	probably null
IGL01792:Tubgcp6	APN	15	89101281	missense	probably damaging	1.00
IGL01866:Tubgcp6	APN	15	89103488	missense	probably benign	0.01
IGL02596:Tubgcp6	APN	15	89100914	missense	probably damaging	1.00
IGL02858:Tubgcp6	APN	15	89102315	nonsense	probably null
IGL02873:Tubgcp6	APN	15	89103824	missense	probably benign	0.00
IGL03400:Tubgcp6	APN	15	89108099	unclassified	probably benign
IGL02796:Tubgcp6	UTSW	15	89122390	missense	probably benign	0.03
R0010:Tubgcp6	UTSW	15	89103183	missense	probably benign	0.00
R0308:Tubgcp6	UTSW	15	89122436	missense	possibly damaging	0.85
R0440:Tubgcp6	UTSW	15	89103065	missense	probably benign	0.12
R0631:Tubgcp6	UTSW	15	89100987	missense	probably damaging	1.00
R1653:Tubgcp6	UTSW	15	89107442	missense	probably damaging	1.00
R1901:Tubgcp6	UTSW	15	89116241	missense	possibly damaging	0.68
R1902:Tubgcp6	UTSW	15	89116241	missense	possibly damaging	0.68
R1905:Tubgcp6	UTSW	15	89100608	missense	probably damaging	1.00
R2005:Tubgcp6	UTSW	15	89104166	missense	probably benign	0.01
R2067:Tubgcp6	UTSW	15	89104489	missense	probably benign	0.03
R2083:Tubgcp6	UTSW	15	89122376	missense	probably damaging	1.00
R2285:Tubgcp6	UTSW	15	89122474	missense	probably damaging	1.00
R2401:Tubgcp6	UTSW	15	89102984	missense	probably benign	0.22
R2436:Tubgcp6	UTSW	15	89102365	missense	probably benign	0.37
R3017:Tubgcp6	UTSW	15	89103082	nonsense	probably null
R3054:Tubgcp6	UTSW	15	89122603	missense	probably damaging	1.00
R3932:Tubgcp6	UTSW	15	89104414	unclassified	probably benign
R4350:Tubgcp6	UTSW	15	89103995	missense	probably benign	0.00
R4472:Tubgcp6	UTSW	15	89103654	missense	probably damaging	0.98
R4864:Tubgcp6	UTSW	15	89103818	missense	probably benign
R4937:Tubgcp6	UTSW	15	89101549	missense	probably damaging	0.98
R4983:Tubgcp6	UTSW	15	89106291	missense	probably damaging	1.00
R4996:Tubgcp6	UTSW	15	89103490	missense	possibly damaging	0.89
R5044:Tubgcp6	UTSW	15	89099545	unclassified	probably benign
R5122:Tubgcp6	UTSW	15	89116103	missense	probably damaging	1.00
R5607:Tubgcp6	UTSW	15	89111150	missense	probably benign	0.02
R5608:Tubgcp6	UTSW	15	89111150	missense	probably benign	0.02
R5653:Tubgcp6	UTSW	15	89108612	missense	possibly damaging	0.47
R5886:Tubgcp6	UTSW	15	89103247	missense	possibly damaging	0.82
R5945:Tubgcp6	UTSW	15	89109217	splice site	probably null
R6111:Tubgcp6	UTSW	15	89100920	missense	possibly damaging	0.83
R6195:Tubgcp6	UTSW	15	89122791	missense	probably benign	0.01
R6792:Tubgcp6	UTSW	15	89122877	start gained	probably benign
R7074:Tubgcp6	UTSW	15	89120636	missense	probably damaging	1.00
R7274:Tubgcp6	UTSW	15	89102970	nonsense	probably null
R7275:Tubgcp6	UTSW	15	89102943	nonsense	probably null
R7514:Tubgcp6	UTSW	15	89120525	missense	probably damaging	1.00
R7540:Tubgcp6	UTSW	15	89102323	missense	possibly damaging	0.48
R7571:Tubgcp6	UTSW	15	89100722	missense	probably damaging	1.00
R7706:Tubgcp6	UTSW	15	89104223	missense	probably benign
R7721:Tubgcp6	UTSW	15	89101401	missense	probably damaging	1.00
R7980:Tubgcp6	UTSW	15	89102029	missense	probably benign	0.03
R7996:Tubgcp6	UTSW	15	89109028	missense	possibly damaging	0.92
R8095:Tubgcp6	UTSW	15	89122774	missense	probably benign	0.07
R8191:Tubgcp6	UTSW	15	89120640	missense	probably damaging	1.00
R8510:Tubgcp6	UTSW	15	89102949	missense	possibly damaging	0.91
R8839:Tubgcp6	UTSW	15	89103478	missense	possibly damaging	0.91
R8862:Tubgcp6	UTSW	15	89122621	missense	probably benign	0.03
R9044:Tubgcp6	UTSW	15	89103194	missense	possibly damaging	0.89
R9321:Tubgcp6	UTSW	15	89107983	missense	probably damaging	1.00
R9402:Tubgcp6	UTSW	15	89102861	missense	probably benign	0.01
R9428:Tubgcp6	UTSW	15	89100897	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CACCTGAAAACAGCCCTGTG -3'
(R):5'- TTGTTATCACCGAGAGCTGC -3'

Sequencing Primer
(F):5'- TGCAGGTACTCGGCATGG -3'
(R):5'- CTGAACAAGTACAGTGGCATCTTCTC -3'

Posted On

2019-05-15