Incidental Mutation 'R7103:Csnka2ip'
List |< first << previous [record 9 of 64] next >> last >|
ID551019
Institutional Source Beutler Lab
Gene Symbol Csnka2ip
Ensembl Gene ENSMUSG00000068167
Gene Namecasein kinase 2, alpha prime interacting protein
SynonymsCkt2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.183) question?
Stock #R7103 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location64477810-64602408 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 64478757 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 415 (V415F)
Ref Sequence ENSEMBL: ENSMUSP00000147880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089279] [ENSMUST00000209382]
Predicted Effect probably benign
Transcript: ENSMUST00000089279
SMART Domains Protein: ENSMUSP00000086692
Gene: ENSMUSG00000068167

DomainStartEndE-ValueType
low complexity region 164 182 N/A INTRINSIC
low complexity region 186 201 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000209382
AA Change: V415F
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 A G 11: 50,737,354 T294A probably damaging Het
Adamtsl2 G A 2: 27,107,461 V893I probably damaging Het
Amph T A 13: 19,149,738 D656E probably benign Het
Aoah T C 13: 21,023,315 F568S probably damaging Het
Atr G A 9: 95,865,372 G236S probably damaging Het
Brd3 T A 2: 27,450,394 Q601L probably damaging Het
Ccar2 T C 14: 70,141,977 E524G probably damaging Het
Cog2 T C 8: 124,541,114 probably null Het
Dmp1 A T 5: 104,211,863 D135V probably damaging Het
Dtna T C 18: 23,653,379 probably null Het
Endou A G 15: 97,718,929 S238P probably damaging Het
Ep400 T A 5: 110,733,785 E779D unknown Het
Fcgbp A G 7: 28,084,962 E149G probably benign Het
G6pc C A 11: 101,374,587 probably null Het
Gm13119 C T 4: 144,363,727 R446C probably benign Het
Gm9573 C A 17: 35,621,540 A585S unknown Het
Gmeb1 T C 4: 132,234,868 H160R probably damaging Het
Gramd1b T C 9: 40,401,606 Y22C unknown Het
Hcrtr2 C T 9: 76,254,511 G199D probably benign Het
Hoxb2 T C 11: 96,353,621 F353L possibly damaging Het
Itpr2 C A 6: 146,325,074 V1391F probably damaging Het
Jakmip2 T A 18: 43,540,583 probably null Het
Kcnmb4 T C 10: 116,473,259 Y88C possibly damaging Het
Kif1a T C 1: 93,077,785 Y89C probably damaging Het
Kif23 T A 9: 61,919,892 K892N probably damaging Het
Lama3 T A 18: 12,531,879 S646T probably benign Het
Lig3 T A 11: 82,797,312 M709K probably benign Het
Mgea5 G A 19: 45,783,166 probably benign Het
Mindy3 C A 2: 12,401,074 A137S possibly damaging Het
Mis18bp1 T C 12: 65,149,283 E569G possibly damaging Het
Misp T A 10: 79,827,165 L472Q probably damaging Het
Mrps5 A T 2: 127,601,410 T303S probably damaging Het
Msh3 T G 13: 92,274,800 I630L probably benign Het
Myo16 A G 8: 10,569,673 Y1408C unknown Het
N4bp2 T C 5: 65,806,846 V746A probably benign Het
Olfr1225 A G 2: 89,170,483 I243T possibly damaging Het
Olfr1423 A G 19: 12,036,388 M118T probably damaging Het
Olfr477 A G 7: 107,990,598 T78A possibly damaging Het
Ostf1 C T 19: 18,596,351 M44I probably null Het
Pik3c2b T G 1: 133,105,974 L1572R probably damaging Het
Pilra T C 5: 137,831,226 D192G possibly damaging Het
Pkhd1l1 A G 15: 44,573,631 I3462V probably benign Het
Plekhh1 A G 12: 79,066,655 D619G probably benign Het
Ptprb T A 10: 116,338,813 Y797N probably damaging Het
Rb1 T C 14: 73,262,644 D521G probably damaging Het
Rnf17 T G 14: 56,471,306 F728V possibly damaging Het
Slc16a4 T C 3: 107,311,471 S463P probably damaging Het
Slc4a1 A T 11: 102,353,867 I634K probably damaging Het
Slc4a1ap T C 5: 31,543,857 V634A probably benign Het
Spam1 A G 6: 24,800,584 M441V probably benign Het
Teddm3 A C 16: 21,152,979 L280* probably null Het
Tmem231 T C 8: 111,918,885 probably null Het
Tom1l1 T C 11: 90,671,081 probably null Het
Topors C T 4: 40,261,706 G526D probably benign Het
Trpm6 A T 19: 18,813,547 I649F possibly damaging Het
Ttc16 T A 2: 32,774,428 M66L probably benign Het
Tubgcp6 A G 15: 89,101,029 F1619L probably damaging Het
Vps13d G T 4: 145,115,492 A2619E Het
Vps8 G A 16: 21,526,441 R838H probably damaging Het
Vwde T A 6: 13,215,800 M86L probably benign Het
Zfp64 A T 2: 168,926,437 D418E probably benign Het
Zfp952 C T 17: 33,003,632 P362S possibly damaging Het
Zglp1 T C 9: 21,066,072 E149G probably benign Het
Other mutations in Csnka2ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02039:Csnka2ip APN 16 64478594 missense probably damaging 0.99
IGL02677:Csnka2ip APN 16 64478312 missense probably damaging 0.99
R0593:Csnka2ip UTSW 16 64478612 missense probably damaging 0.99
R1075:Csnka2ip UTSW 16 64477947 nonsense probably null
R1698:Csnka2ip UTSW 16 64478059 nonsense probably null
R1815:Csnka2ip UTSW 16 64478492 missense probably benign
R6446:Csnka2ip UTSW 16 64479381 nonsense probably null
R6709:Csnka2ip UTSW 16 64478569 missense possibly damaging 0.92
R6937:Csnka2ip UTSW 16 64478695 utr 5 prime probably benign
R6999:Csnka2ip UTSW 16 64478570 missense unknown
R7013:Csnka2ip UTSW 16 64478417 missense unknown
R7395:Csnka2ip UTSW 16 64479440 missense
R7816:Csnka2ip UTSW 16 64479489 unclassified probably benign
R8301:Csnka2ip UTSW 16 64478991 missense unknown
R8416:Csnka2ip UTSW 16 64479932 missense
Predicted Primers PCR Primer
(F):5'- GACAAAGAGGGTTGCGCATC -3'
(R):5'- CCTCAGGTCAAAGAGTATCAAGTCC -3'

Sequencing Primer
(F):5'- TCCTGAAAGATGGTTACACTGG -3'
(R):5'- GAGTATCAAGTCCTAAGCCCTGTATC -3'
Posted On2019-05-15