Incidental Mutation 'R7103:Olfr1423'
List |< first << previous [record 38 of 64] next >> last >|
ID551024
Institutional Source Beutler Lab
Gene Symbol Olfr1423
Ensembl Gene ENSMUSG00000067529
Gene Nameolfactory receptor 1423
SynonymsMOR239-3, GA_x6K02T2RE5P-2393361-2392429
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.488) question?
Stock #R7103 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location12031787-12041317 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12036388 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 118 (M118T)
Ref Sequence ENSEMBL: ENSMUSP00000150649 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087831] [ENSMUST00000214472]
Predicted Effect probably damaging
Transcript: ENSMUST00000087831
AA Change: M118T

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000085134
Gene: ENSMUSG00000067529
AA Change: M118T

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 2.7e-48 PFAM
Pfam:7tm_1 41 287 2.5e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214472
AA Change: M118T

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 A G 11: 50,737,354 T294A probably damaging Het
Adamtsl2 G A 2: 27,107,461 V893I probably damaging Het
Amph T A 13: 19,149,738 D656E probably benign Het
Aoah T C 13: 21,023,315 F568S probably damaging Het
Atr G A 9: 95,865,372 G236S probably damaging Het
Brd3 T A 2: 27,450,394 Q601L probably damaging Het
Ccar2 T C 14: 70,141,977 E524G probably damaging Het
Cog2 T C 8: 124,541,114 probably null Het
Csnka2ip C A 16: 64,478,757 V415F unknown Het
Dmp1 A T 5: 104,211,863 D135V probably damaging Het
Dtna T C 18: 23,653,379 probably null Het
Endou A G 15: 97,718,929 S238P probably damaging Het
Ep400 T A 5: 110,733,785 E779D unknown Het
Fcgbp A G 7: 28,084,962 E149G probably benign Het
G6pc C A 11: 101,374,587 probably null Het
Gm13119 C T 4: 144,363,727 R446C probably benign Het
Gm9573 C A 17: 35,621,540 A585S unknown Het
Gmeb1 T C 4: 132,234,868 H160R probably damaging Het
Gramd1b T C 9: 40,401,606 Y22C unknown Het
Hcrtr2 C T 9: 76,254,511 G199D probably benign Het
Hoxb2 T C 11: 96,353,621 F353L possibly damaging Het
Itpr2 C A 6: 146,325,074 V1391F probably damaging Het
Jakmip2 T A 18: 43,540,583 probably null Het
Kcnmb4 T C 10: 116,473,259 Y88C possibly damaging Het
Kif1a T C 1: 93,077,785 Y89C probably damaging Het
Kif23 T A 9: 61,919,892 K892N probably damaging Het
Lama3 T A 18: 12,531,879 S646T probably benign Het
Lig3 T A 11: 82,797,312 M709K probably benign Het
Mgea5 G A 19: 45,783,166 probably benign Het
Mindy3 C A 2: 12,401,074 A137S possibly damaging Het
Mis18bp1 T C 12: 65,149,283 E569G possibly damaging Het
Misp T A 10: 79,827,165 L472Q probably damaging Het
Mrps5 A T 2: 127,601,410 T303S probably damaging Het
Msh3 T G 13: 92,274,800 I630L probably benign Het
Myo16 A G 8: 10,569,673 Y1408C unknown Het
N4bp2 T C 5: 65,806,846 V746A probably benign Het
Olfr1225 A G 2: 89,170,483 I243T possibly damaging Het
Olfr477 A G 7: 107,990,598 T78A possibly damaging Het
Ostf1 C T 19: 18,596,351 M44I probably null Het
Pik3c2b T G 1: 133,105,974 L1572R probably damaging Het
Pilra T C 5: 137,831,226 D192G possibly damaging Het
Pkhd1l1 A G 15: 44,573,631 I3462V probably benign Het
Plekhh1 A G 12: 79,066,655 D619G probably benign Het
Ptprb T A 10: 116,338,813 Y797N probably damaging Het
Rb1 T C 14: 73,262,644 D521G probably damaging Het
Rnf17 T G 14: 56,471,306 F728V possibly damaging Het
Slc16a4 T C 3: 107,311,471 S463P probably damaging Het
Slc4a1 A T 11: 102,353,867 I634K probably damaging Het
Slc4a1ap T C 5: 31,543,857 V634A probably benign Het
Spam1 A G 6: 24,800,584 M441V probably benign Het
Teddm3 A C 16: 21,152,979 L280* probably null Het
Tmem231 T C 8: 111,918,885 probably null Het
Tom1l1 T C 11: 90,671,081 probably null Het
Topors C T 4: 40,261,706 G526D probably benign Het
Trpm6 A T 19: 18,813,547 I649F possibly damaging Het
Ttc16 T A 2: 32,774,428 M66L probably benign Het
Tubgcp6 A G 15: 89,101,029 F1619L probably damaging Het
Vps13d G T 4: 145,115,492 A2619E Het
Vps8 G A 16: 21,526,441 R838H probably damaging Het
Vwde T A 6: 13,215,800 M86L probably benign Het
Zfp64 A T 2: 168,926,437 D418E probably benign Het
Zfp952 C T 17: 33,003,632 P362S possibly damaging Het
Zglp1 T C 9: 21,066,072 E149G probably benign Het
Other mutations in Olfr1423
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01333:Olfr1423 APN 19 12035941 missense probably benign 0.36
IGL01843:Olfr1423 APN 19 12036677 missense probably benign
IGL01915:Olfr1423 APN 19 12036097 missense probably damaging 1.00
IGL02283:Olfr1423 APN 19 12035855 missense possibly damaging 0.87
IGL02807:Olfr1423 APN 19 12036284 missense probably benign 0.12
IGL02976:Olfr1423 APN 19 12035973 nonsense probably null
IGL03142:Olfr1423 APN 19 12036388 missense probably damaging 1.00
R0326:Olfr1423 UTSW 19 12036161 missense probably benign 0.00
R0369:Olfr1423 UTSW 19 12036401 missense probably benign 0.01
R0614:Olfr1423 UTSW 19 12036565 missense possibly damaging 0.93
R1940:Olfr1423 UTSW 19 12035911 missense probably benign 0.06
R1978:Olfr1423 UTSW 19 12036341 missense probably benign 0.06
R2013:Olfr1423 UTSW 19 12036154 missense probably damaging 1.00
R2179:Olfr1423 UTSW 19 12036088 missense probably damaging 1.00
R3972:Olfr1423 UTSW 19 12036019 missense probably damaging 0.98
R5051:Olfr1423 UTSW 19 12035924 missense possibly damaging 0.88
R5484:Olfr1423 UTSW 19 12035828 missense probably benign 0.01
R5518:Olfr1423 UTSW 19 12036065 missense probably damaging 0.97
R5729:Olfr1423 UTSW 19 12035908 missense probably damaging 0.99
R6151:Olfr1423 UTSW 19 12036736 missense probably benign 0.00
R6708:Olfr1423 UTSW 19 12036739 start codon destroyed probably null 1.00
R6723:Olfr1423 UTSW 19 12036275 missense probably damaging 1.00
R7385:Olfr1423 UTSW 19 12035999 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- GCAGGCAAGTTTGAGAACC -3'
(R):5'- ACACGCCCATGTACTTCCTG -3'

Sequencing Primer
(F):5'- TTGAGAACCTGTGGGACATCGC -3'
(R):5'- TGCTCCGAAACCTTGCCG -3'
Posted On2019-05-15