Incidental Mutation 'R7104:Or5j3'
ID 551033
Institutional Source Beutler Lab
Gene Symbol Or5j3
Ensembl Gene ENSMUSG00000047149
Gene Name olfactory receptor family 5 subfamily J member 3
Synonyms GA_x6K02T2Q125-47777498-47778436, Olfr1052, MOR172-1
MMRRC Submission 045196-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.138) question?
Stock # R7104 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 86128162-86129100 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 86128564 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 135 (S135T)
Ref Sequence ENSEMBL: ENSMUSP00000149344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054746] [ENSMUST00000215090] [ENSMUST00000217166]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000054746
AA Change: S135T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000058454
Gene: ENSMUSG00000047149
AA Change: S135T

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.3e-51 PFAM
Pfam:7tm_1 41 290 6.9e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215090
AA Change: S135T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000217166
AA Change: S135T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl2 A G 2: 90,627,891 (GRCm39) E232G probably damaging Het
Atf7 A G 15: 102,442,670 (GRCm39) S480P probably benign Het
Cdk14 A G 5: 5,245,325 (GRCm39) I166T possibly damaging Het
Cdk5rap2 G T 4: 70,267,393 (GRCm39) F358L probably benign Het
Cplane1 T C 15: 8,223,928 (GRCm39) L897P possibly damaging Het
Cytip A G 2: 58,049,986 (GRCm39) S28P probably benign Het
Dennd5b C T 6: 148,946,102 (GRCm39) R503Q probably damaging Het
Dnajc10 T A 2: 80,171,159 (GRCm39) C480S probably damaging Het
Drc7 A G 8: 95,785,711 (GRCm39) D189G probably damaging Het
Engase G A 11: 118,372,121 (GRCm39) V138M probably damaging Het
Esyt3 C A 9: 99,220,840 (GRCm39) R121L probably damaging Het
Frem1 T G 4: 82,858,918 (GRCm39) I1516L probably benign Het
Gatad2b T A 3: 90,258,724 (GRCm39) I249N probably damaging Het
Grk6 T C 13: 55,602,219 (GRCm39) S383P probably benign Het
Hectd1 C T 12: 51,874,134 (GRCm39) probably null Het
Hipk2 A G 6: 38,795,579 (GRCm39) L230P probably damaging Het
Hivep1 A T 13: 42,310,814 (GRCm39) Q1018L probably benign Het
Itgad T C 7: 127,797,550 (GRCm39) F927S probably benign Het
Itgb3bp A G 4: 99,702,335 (GRCm39) V3A probably damaging Het
Kcnh7 G T 2: 62,618,031 (GRCm39) A486D possibly damaging Het
Krt1c T C 15: 101,723,522 (GRCm39) T318A probably benign Het
Ndrg1 A G 15: 66,818,377 (GRCm39) F77S probably damaging Het
Nlrp4c T A 7: 6,068,708 (GRCm39) L203* probably null Het
Nos1 T A 5: 118,085,496 (GRCm39) C1275S probably damaging Het
Or14a256 T C 7: 86,264,900 (GRCm39) S318G probably null Het
Or4a69 A G 2: 89,313,458 (GRCm39) V7A possibly damaging Het
Or5an9 T C 19: 12,187,242 (GRCm39) I104T possibly damaging Het
Or5d39 T C 2: 87,979,716 (GRCm39) T216A possibly damaging Het
Or8b12b A T 9: 37,684,437 (GRCm39) N161Y possibly damaging Het
Pip4k2b T C 11: 97,623,542 (GRCm39) M67V possibly damaging Het
Polq C A 16: 36,909,715 (GRCm39) Y2366* probably null Het
Prg3 T C 2: 84,819,097 (GRCm39) S8P probably benign Het
Prl7c1 A T 13: 27,962,952 (GRCm39) L17* probably null Het
Prl8a8 A T 13: 27,695,479 (GRCm39) S51R probably damaging Het
Pttg1 G C 11: 43,311,976 (GRCm39) P160A probably benign Het
Rbfox1 C A 16: 7,170,867 (GRCm39) R276S possibly damaging Het
Rnase2a T G 14: 51,492,988 (GRCm39) M126L probably benign Het
Secisbp2 A T 13: 51,810,943 (GRCm39) K202* probably null Het
Sema6c A G 3: 95,076,156 (GRCm39) H236R possibly damaging Het
Septin12 A G 16: 4,809,857 (GRCm39) L181P probably damaging Het
Shc3 A T 13: 51,585,241 (GRCm39) V458D possibly damaging Het
Tecta A G 9: 42,278,239 (GRCm39) Y1090H probably benign Het
Thsd7a A T 6: 12,379,429 (GRCm39) N998K Het
Tmem131l A T 3: 83,826,766 (GRCm39) S1184T possibly damaging Het
Tnfsf15 T C 4: 63,647,887 (GRCm39) D251G probably damaging Het
Ttyh3 T C 5: 140,615,540 (GRCm39) E348G probably benign Het
Unc5c T C 3: 141,439,665 (GRCm39) L186P probably damaging Het
Vmn2r37 A T 7: 9,219,045 (GRCm39) N446K probably damaging Het
Vmn2r63 T C 7: 42,577,959 (GRCm39) D193G possibly damaging Het
Vmn2r85 A T 10: 130,262,376 (GRCm39) M121K probably benign Het
Vmn2r88 A G 14: 51,651,253 (GRCm39) D189G Het
Vwc2l C A 1: 70,768,252 (GRCm39) C105* probably null Het
Wdr72 T A 9: 74,055,597 (GRCm39) D275E probably damaging Het
Zfhx4 A T 3: 5,467,549 (GRCm39) D2594V probably damaging Het
Zfp174 C T 16: 3,672,269 (GRCm39) H273Y probably benign Het
Zwilch A G 9: 64,068,658 (GRCm39) S203P probably damaging Het
Other mutations in Or5j3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02632:Or5j3 APN 2 86,128,904 (GRCm39) missense probably damaging 0.99
IGL02988:Or5j3 UTSW 2 86,128,823 (GRCm39) missense probably damaging 0.99
R0382:Or5j3 UTSW 2 86,128,937 (GRCm39) missense probably damaging 1.00
R0569:Or5j3 UTSW 2 86,128,941 (GRCm39) missense probably damaging 1.00
R1476:Or5j3 UTSW 2 86,128,823 (GRCm39) missense probably damaging 0.99
R1510:Or5j3 UTSW 2 86,128,715 (GRCm39) missense probably damaging 1.00
R1667:Or5j3 UTSW 2 86,129,080 (GRCm39) missense probably null 0.02
R2912:Or5j3 UTSW 2 86,128,733 (GRCm39) missense probably damaging 0.96
R2913:Or5j3 UTSW 2 86,128,733 (GRCm39) missense probably damaging 0.96
R3937:Or5j3 UTSW 2 86,128,360 (GRCm39) missense probably damaging 1.00
R4299:Or5j3 UTSW 2 86,128,585 (GRCm39) missense possibly damaging 0.46
R4774:Or5j3 UTSW 2 86,129,042 (GRCm39) missense possibly damaging 0.91
R5027:Or5j3 UTSW 2 86,128,540 (GRCm39) missense possibly damaging 0.84
R5080:Or5j3 UTSW 2 86,128,258 (GRCm39) missense probably benign 0.22
R5254:Or5j3 UTSW 2 86,128,265 (GRCm39) missense probably damaging 1.00
R5389:Or5j3 UTSW 2 86,128,561 (GRCm39) missense possibly damaging 0.90
R6110:Or5j3 UTSW 2 86,129,019 (GRCm39) missense probably damaging 0.99
R6492:Or5j3 UTSW 2 86,128,990 (GRCm39) missense probably benign 0.05
R6810:Or5j3 UTSW 2 86,128,267 (GRCm39) missense probably benign 0.01
R7095:Or5j3 UTSW 2 86,129,021 (GRCm39) missense probably benign 0.08
R7320:Or5j3 UTSW 2 86,128,338 (GRCm39) frame shift probably null
R7328:Or5j3 UTSW 2 86,128,338 (GRCm39) frame shift probably null
R7363:Or5j3 UTSW 2 86,128,338 (GRCm39) frame shift probably null
R8048:Or5j3 UTSW 2 86,128,672 (GRCm39) missense probably benign 0.04
R8202:Or5j3 UTSW 2 86,128,968 (GRCm39) missense probably benign 0.06
R8968:Or5j3 UTSW 2 86,128,526 (GRCm39) missense probably benign 0.00
R9160:Or5j3 UTSW 2 86,128,330 (GRCm39) missense probably benign 0.40
R9321:Or5j3 UTSW 2 86,128,297 (GRCm39) missense probably benign 0.01
R9694:Or5j3 UTSW 2 86,128,718 (GRCm39) missense probably benign 0.03
Z1176:Or5j3 UTSW 2 86,128,570 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCCTGTTATTCATCAGTCATTGCAC -3'
(R):5'- ACCAATGGCGATAACTCCAGAG -3'

Sequencing Primer
(F):5'- CAGTCATTGCACCAAAAATGTTG -3'
(R):5'- CATTCATGGAGGTATCAGAACATG -3'
Posted On 2019-05-15