Incidental Mutation 'R7104:Olfr1167'
ID551034
Institutional Source Beutler Lab
Gene Symbol Olfr1167
Ensembl Gene ENSMUSG00000100899
Gene Nameolfactory receptor 1167
SynonymsMOR174-16, GA_x6K02T2Q125-49641892-49640942
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R7104 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location88146150-88155193 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88149372 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 216 (T216A)
Ref Sequence ENSEMBL: ENSMUSP00000149599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099832] [ENSMUST00000216951]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099832
AA Change: T216A

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000097420
Gene: ENSMUSG00000100899
AA Change: T216A

DomainStartEndE-ValueType
Pfam:7tm_4 33 310 1.3e-47 PFAM
Pfam:7tm_1 43 292 3e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000216951
AA Change: T216A

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,194,444 L897P possibly damaging Het
Agbl2 A G 2: 90,797,547 E232G probably damaging Het
Atf7 A G 15: 102,534,235 S480P probably benign Het
Cdk14 A G 5: 5,195,325 I166T possibly damaging Het
Cdk5rap2 G T 4: 70,349,156 F358L probably benign Het
Cytip A G 2: 58,159,974 S28P probably benign Het
Dennd5b C T 6: 149,044,604 R503Q probably damaging Het
Dnajc10 T A 2: 80,340,815 C480S probably damaging Het
Drc7 A G 8: 95,059,083 D189G probably damaging Het
Engase G A 11: 118,481,295 V138M probably damaging Het
Esyt3 C A 9: 99,338,787 R121L probably damaging Het
Frem1 T G 4: 82,940,681 I1516L probably benign Het
Gatad2b T A 3: 90,351,417 I249N probably damaging Het
Grk6 T C 13: 55,454,406 S383P probably benign Het
Hectd1 C T 12: 51,827,351 probably null Het
Hipk2 A G 6: 38,818,644 L230P probably damaging Het
Hivep1 A T 13: 42,157,338 Q1018L probably benign Het
Itgad T C 7: 128,198,378 F927S probably benign Het
Itgb3bp A G 4: 99,814,098 V3A probably damaging Het
Kcnh7 G T 2: 62,787,687 A486D possibly damaging Het
Krt2 T C 15: 101,815,087 T318A probably benign Het
Ndrg1 A G 15: 66,946,528 F77S probably damaging Het
Nlrp4c T A 7: 6,065,709 L203* probably null Het
Nos1 T A 5: 117,947,431 C1275S probably damaging Het
Olfr1052 T A 2: 86,298,220 S135T probably benign Het
Olfr1241 A G 2: 89,483,114 V7A possibly damaging Het
Olfr1431 T C 19: 12,209,878 I104T possibly damaging Het
Olfr294 T C 7: 86,615,692 S318G probably null Het
Olfr875 A T 9: 37,773,141 N161Y possibly damaging Het
Pip4k2b T C 11: 97,732,716 M67V possibly damaging Het
Polq C A 16: 37,089,353 Y2366* probably null Het
Prg3 T C 2: 84,988,753 S8P probably benign Het
Prl7c1 A T 13: 27,778,969 L17* probably null Het
Prl8a8 A T 13: 27,511,496 S51R probably damaging Het
Pttg1 G C 11: 43,421,149 P160A probably benign Het
Rbfox1 C A 16: 7,353,003 R276S possibly damaging Het
Rnase2a T G 14: 51,255,531 M126L probably benign Het
Secisbp2 A T 13: 51,656,907 K202* probably null Het
Sema6c A G 3: 95,168,845 H236R possibly damaging Het
Sept12 A G 16: 4,991,993 L181P probably damaging Het
Shc3 A T 13: 51,431,205 V458D possibly damaging Het
Tecta A G 9: 42,366,943 Y1090H probably benign Het
Thsd7a A T 6: 12,379,430 N998K Het
Tmem131l A T 3: 83,919,459 S1184T possibly damaging Het
Tnfsf15 T C 4: 63,729,650 D251G probably damaging Het
Ttyh3 T C 5: 140,629,785 E348G probably benign Het
Unc5c T C 3: 141,733,904 L186P probably damaging Het
Vmn2r37 A T 7: 9,216,046 N446K probably damaging Het
Vmn2r63 T C 7: 42,928,535 D193G possibly damaging Het
Vmn2r85 A T 10: 130,426,507 M121K probably benign Het
Vmn2r88 A G 14: 51,413,796 D189G Het
Vwc2l C A 1: 70,729,093 C105* probably null Het
Wdr72 T A 9: 74,148,315 D275E probably damaging Het
Zfhx4 A T 3: 5,402,489 D2594V probably damaging Het
Zfp174 C T 16: 3,854,405 H273Y probably benign Het
Zwilch A G 9: 64,161,376 S203P probably damaging Het
Other mutations in Olfr1167
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Olfr1167 APN 2 88149260 missense possibly damaging 0.55
IGL01525:Olfr1167 APN 2 88149877 missense probably benign 0.15
IGL02008:Olfr1167 APN 2 88149578 missense probably damaging 1.00
IGL02116:Olfr1167 APN 2 88149288 missense probably benign 0.03
IGL02740:Olfr1167 APN 2 88149257 missense probably damaging 1.00
IGL03493:Olfr1167 APN 2 88149936 missense probably benign 0.02
PIT4498001:Olfr1167 UTSW 2 88149915 missense probably benign 0.00
R1951:Olfr1167 UTSW 2 88149297 missense possibly damaging 0.50
R2060:Olfr1167 UTSW 2 88149143 missense probably damaging 1.00
R4167:Olfr1167 UTSW 2 88149845 missense probably damaging 0.97
R4168:Olfr1167 UTSW 2 88149845 missense probably damaging 0.97
R4244:Olfr1167 UTSW 2 88149288 missense probably benign 0.00
R5363:Olfr1167 UTSW 2 88149802 missense probably damaging 1.00
R5778:Olfr1167 UTSW 2 88149617 missense probably damaging 1.00
R5939:Olfr1167 UTSW 2 88149509 missense probably damaging 1.00
R6502:Olfr1167 UTSW 2 88150016 start codon destroyed probably null 0.37
R7036:Olfr1167 UTSW 2 88149125 missense probably damaging 0.99
R7340:Olfr1167 UTSW 2 88149276 missense possibly damaging 0.95
R7481:Olfr1167 UTSW 2 88149761 missense probably benign 0.12
R7615:Olfr1167 UTSW 2 88149518 missense probably benign 0.01
X0050:Olfr1167 UTSW 2 88149696 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAAGAGCAGTGGCCACTTTG -3'
(R):5'- AGTAGCTGGGACATATATGATCG -3'

Sequencing Primer
(F):5'- GCCACTTTGACAAAGAGCCGTG -3'
(R):5'- CTGGGACATATATGATCGGTGGAC -3'
Posted On2019-05-15