Incidental Mutation 'R7104:Agbl2'
ID551036
Institutional Source Beutler Lab
Gene Symbol Agbl2
Ensembl Gene ENSMUSG00000040812
Gene NameATP/GTP binding protein-like 2
SynonymsA430081C19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7104 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location90782727-90834437 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 90797547 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 232 (E232G)
Ref Sequence ENSEMBL: ENSMUSP00000048647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037206] [ENSMUST00000037219] [ENSMUST00000051831] [ENSMUST00000111481] [ENSMUST00000136058] [ENSMUST00000170320]
Predicted Effect probably damaging
Transcript: ENSMUST00000037206
AA Change: E232G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047936
Gene: ENSMUSG00000040812
AA Change: E232G

DomainStartEndE-ValueType
low complexity region 98 106 N/A INTRINSIC
Pfam:Peptidase_M14 375 541 1.8e-18 PFAM
low complexity region 640 655 N/A INTRINSIC
low complexity region 674 689 N/A INTRINSIC
low complexity region 761 776 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000037219
AA Change: E232G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000048647
Gene: ENSMUSG00000040812
AA Change: E232G

DomainStartEndE-ValueType
low complexity region 98 106 N/A INTRINSIC
Pfam:Peptidase_M14 374 618 5e-32 PFAM
low complexity region 640 655 N/A INTRINSIC
low complexity region 674 689 N/A INTRINSIC
low complexity region 761 776 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000051831
AA Change: E232G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000051620
Gene: ENSMUSG00000040812
AA Change: E232G

DomainStartEndE-ValueType
low complexity region 98 106 N/A INTRINSIC
Pfam:Peptidase_M14 376 565 1.6e-18 PFAM
low complexity region 640 655 N/A INTRINSIC
low complexity region 674 689 N/A INTRINSIC
low complexity region 761 776 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111481
AA Change: E232G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107106
Gene: ENSMUSG00000040812
AA Change: E232G

DomainStartEndE-ValueType
low complexity region 98 106 N/A INTRINSIC
Pfam:Peptidase_M14 374 618 5e-32 PFAM
low complexity region 640 655 N/A INTRINSIC
low complexity region 674 689 N/A INTRINSIC
low complexity region 761 776 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000136058
AA Change: E232G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115632
Gene: ENSMUSG00000040812
AA Change: E232G

DomainStartEndE-ValueType
low complexity region 98 106 N/A INTRINSIC
Pfam:Peptidase_M14 374 618 2.8e-32 PFAM
low complexity region 640 655 N/A INTRINSIC
low complexity region 674 689 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170320
AA Change: E232G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129216
Gene: ENSMUSG00000040812
AA Change: E232G

DomainStartEndE-ValueType
low complexity region 98 106 N/A INTRINSIC
Pfam:Peptidase_M14 376 558 1.8e-18 PFAM
low complexity region 640 655 N/A INTRINSIC
low complexity region 674 689 N/A INTRINSIC
low complexity region 761 776 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mice for a targeted allele are viable and fertile. Mice exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,194,444 L897P possibly damaging Het
Atf7 A G 15: 102,534,235 S480P probably benign Het
Cdk14 A G 5: 5,195,325 I166T possibly damaging Het
Cdk5rap2 G T 4: 70,349,156 F358L probably benign Het
Cytip A G 2: 58,159,974 S28P probably benign Het
Dennd5b C T 6: 149,044,604 R503Q probably damaging Het
Dnajc10 T A 2: 80,340,815 C480S probably damaging Het
Drc7 A G 8: 95,059,083 D189G probably damaging Het
Engase G A 11: 118,481,295 V138M probably damaging Het
Esyt3 C A 9: 99,338,787 R121L probably damaging Het
Frem1 T G 4: 82,940,681 I1516L probably benign Het
Gatad2b T A 3: 90,351,417 I249N probably damaging Het
Grk6 T C 13: 55,454,406 S383P probably benign Het
Hectd1 C T 12: 51,827,351 probably null Het
Hipk2 A G 6: 38,818,644 L230P probably damaging Het
Hivep1 A T 13: 42,157,338 Q1018L probably benign Het
Itgad T C 7: 128,198,378 F927S probably benign Het
Itgb3bp A G 4: 99,814,098 V3A probably damaging Het
Kcnh7 G T 2: 62,787,687 A486D possibly damaging Het
Krt2 T C 15: 101,815,087 T318A probably benign Het
Ndrg1 A G 15: 66,946,528 F77S probably damaging Het
Nlrp4c T A 7: 6,065,709 L203* probably null Het
Nos1 T A 5: 117,947,431 C1275S probably damaging Het
Olfr1052 T A 2: 86,298,220 S135T probably benign Het
Olfr1167 T C 2: 88,149,372 T216A possibly damaging Het
Olfr1241 A G 2: 89,483,114 V7A possibly damaging Het
Olfr1431 T C 19: 12,209,878 I104T possibly damaging Het
Olfr294 T C 7: 86,615,692 S318G probably null Het
Olfr875 A T 9: 37,773,141 N161Y possibly damaging Het
Pip4k2b T C 11: 97,732,716 M67V possibly damaging Het
Polq C A 16: 37,089,353 Y2366* probably null Het
Prg3 T C 2: 84,988,753 S8P probably benign Het
Prl7c1 A T 13: 27,778,969 L17* probably null Het
Prl8a8 A T 13: 27,511,496 S51R probably damaging Het
Pttg1 G C 11: 43,421,149 P160A probably benign Het
Rbfox1 C A 16: 7,353,003 R276S possibly damaging Het
Rnase2a T G 14: 51,255,531 M126L probably benign Het
Secisbp2 A T 13: 51,656,907 K202* probably null Het
Sema6c A G 3: 95,168,845 H236R possibly damaging Het
Sept12 A G 16: 4,991,993 L181P probably damaging Het
Shc3 A T 13: 51,431,205 V458D possibly damaging Het
Tecta A G 9: 42,366,943 Y1090H probably benign Het
Thsd7a A T 6: 12,379,430 N998K Het
Tmem131l A T 3: 83,919,459 S1184T possibly damaging Het
Tnfsf15 T C 4: 63,729,650 D251G probably damaging Het
Ttyh3 T C 5: 140,629,785 E348G probably benign Het
Unc5c T C 3: 141,733,904 L186P probably damaging Het
Vmn2r37 A T 7: 9,216,046 N446K probably damaging Het
Vmn2r63 T C 7: 42,928,535 D193G possibly damaging Het
Vmn2r85 A T 10: 130,426,507 M121K probably benign Het
Vmn2r88 A G 14: 51,413,796 D189G Het
Vwc2l C A 1: 70,729,093 C105* probably null Het
Wdr72 T A 9: 74,148,315 D275E probably damaging Het
Zfhx4 A T 3: 5,402,489 D2594V probably damaging Het
Zfp174 C T 16: 3,854,405 H273Y probably benign Het
Zwilch A G 9: 64,161,376 S203P probably damaging Het
Other mutations in Agbl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Agbl2 APN 2 90801045 missense probably damaging 1.00
IGL00515:Agbl2 APN 2 90793960 missense possibly damaging 0.93
IGL01694:Agbl2 APN 2 90801074 missense probably damaging 1.00
IGL02064:Agbl2 APN 2 90784024 utr 5 prime probably benign
IGL02708:Agbl2 APN 2 90801342 missense probably benign 0.23
IGL02715:Agbl2 APN 2 90805868 missense probably damaging 0.99
IGL02717:Agbl2 APN 2 90805868 missense probably damaging 0.99
IGL02982:Agbl2 APN 2 90805815 missense probably damaging 1.00
IGL03039:Agbl2 APN 2 90801222 missense possibly damaging 0.93
IGL03339:Agbl2 APN 2 90797563 missense probably damaging 1.00
R0243:Agbl2 UTSW 2 90791481 missense possibly damaging 0.80
R0381:Agbl2 UTSW 2 90784098 missense probably damaging 1.00
R0441:Agbl2 UTSW 2 90797483 nonsense probably null
R0549:Agbl2 UTSW 2 90789843 splice site probably benign
R0665:Agbl2 UTSW 2 90801210 missense probably damaging 1.00
R1412:Agbl2 UTSW 2 90788954 missense probably benign
R1682:Agbl2 UTSW 2 90784090 missense probably benign 0.06
R1694:Agbl2 UTSW 2 90801320 missense probably damaging 1.00
R1733:Agbl2 UTSW 2 90810745 missense probably damaging 1.00
R1750:Agbl2 UTSW 2 90816376 utr 3 prime probably benign
R1916:Agbl2 UTSW 2 90815441 missense possibly damaging 0.73
R1940:Agbl2 UTSW 2 90811282 missense probably damaging 0.99
R3115:Agbl2 UTSW 2 90805901 missense possibly damaging 0.85
R3407:Agbl2 UTSW 2 90791618 missense probably damaging 1.00
R3710:Agbl2 UTSW 2 90805808 missense probably benign 0.00
R4227:Agbl2 UTSW 2 90801453 missense probably damaging 0.96
R4719:Agbl2 UTSW 2 90815389 missense probably benign 0.01
R4903:Agbl2 UTSW 2 90797473 missense possibly damaging 0.50
R5170:Agbl2 UTSW 2 90803197 missense probably benign 0.10
R5535:Agbl2 UTSW 2 90810006 missense probably benign 0.26
R5677:Agbl2 UTSW 2 90807978 missense possibly damaging 0.66
R6041:Agbl2 UTSW 2 90808027 missense probably benign 0.00
R6195:Agbl2 UTSW 2 90813313 missense probably benign 0.02
R6233:Agbl2 UTSW 2 90813313 missense probably benign 0.02
R6607:Agbl2 UTSW 2 90801326 missense probably damaging 0.99
R6752:Agbl2 UTSW 2 90803074 missense probably damaging 1.00
R7261:Agbl2 UTSW 2 90788944 missense possibly damaging 0.94
R7555:Agbl2 UTSW 2 90791555 missense probably damaging 1.00
R7704:Agbl2 UTSW 2 90789005 missense probably benign 0.05
R7833:Agbl2 UTSW 2 90815433 missense probably benign 0.00
R7960:Agbl2 UTSW 2 90791631 missense probably benign 0.01
R8070:Agbl2 UTSW 2 90791565 missense probably benign 0.00
R8248:Agbl2 UTSW 2 90797564 missense probably damaging 1.00
R8249:Agbl2 UTSW 2 90797564 missense probably damaging 1.00
R8250:Agbl2 UTSW 2 90797564 missense probably damaging 1.00
R8501:Agbl2 UTSW 2 90797564 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTGCTGAGTGAATGCATTCTG -3'
(R):5'- CGGATCCAACTTTTAAGTGATCTC -3'

Sequencing Primer
(F):5'- CATTCTGAGTGGAGCATTAGCCTC -3'
(R):5'- TGATTCCTGGAGTCGTTC -3'
Posted On2019-05-15