Incidental Mutation 'R7104:Agbl2'
ID 551036
Institutional Source Beutler Lab
Gene Symbol Agbl2
Ensembl Gene ENSMUSG00000040812
Gene Name ATP/GTP binding protein-like 2
Synonyms Ccp2, A430081C19Rik, Ccp2
MMRRC Submission 045196-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7104 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 90613071-90664781 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 90627891 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 232 (E232G)
Ref Sequence ENSEMBL: ENSMUSP00000048647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037206] [ENSMUST00000037219] [ENSMUST00000051831] [ENSMUST00000111481] [ENSMUST00000136058] [ENSMUST00000170320]
AlphaFold Q8CDK2
Predicted Effect probably damaging
Transcript: ENSMUST00000037206
AA Change: E232G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047936
Gene: ENSMUSG00000040812
AA Change: E232G

DomainStartEndE-ValueType
low complexity region 98 106 N/A INTRINSIC
Pfam:Peptidase_M14 375 541 1.8e-18 PFAM
low complexity region 640 655 N/A INTRINSIC
low complexity region 674 689 N/A INTRINSIC
low complexity region 761 776 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000037219
AA Change: E232G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000048647
Gene: ENSMUSG00000040812
AA Change: E232G

DomainStartEndE-ValueType
low complexity region 98 106 N/A INTRINSIC
Pfam:Peptidase_M14 374 618 5e-32 PFAM
low complexity region 640 655 N/A INTRINSIC
low complexity region 674 689 N/A INTRINSIC
low complexity region 761 776 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000051831
AA Change: E232G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000051620
Gene: ENSMUSG00000040812
AA Change: E232G

DomainStartEndE-ValueType
low complexity region 98 106 N/A INTRINSIC
Pfam:Peptidase_M14 376 565 1.6e-18 PFAM
low complexity region 640 655 N/A INTRINSIC
low complexity region 674 689 N/A INTRINSIC
low complexity region 761 776 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111481
AA Change: E232G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107106
Gene: ENSMUSG00000040812
AA Change: E232G

DomainStartEndE-ValueType
low complexity region 98 106 N/A INTRINSIC
Pfam:Peptidase_M14 374 618 5e-32 PFAM
low complexity region 640 655 N/A INTRINSIC
low complexity region 674 689 N/A INTRINSIC
low complexity region 761 776 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000136058
AA Change: E232G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115632
Gene: ENSMUSG00000040812
AA Change: E232G

DomainStartEndE-ValueType
low complexity region 98 106 N/A INTRINSIC
Pfam:Peptidase_M14 374 618 2.8e-32 PFAM
low complexity region 640 655 N/A INTRINSIC
low complexity region 674 689 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170320
AA Change: E232G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129216
Gene: ENSMUSG00000040812
AA Change: E232G

DomainStartEndE-ValueType
low complexity region 98 106 N/A INTRINSIC
Pfam:Peptidase_M14 376 558 1.8e-18 PFAM
low complexity region 640 655 N/A INTRINSIC
low complexity region 674 689 N/A INTRINSIC
low complexity region 761 776 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mice for a targeted allele are viable and fertile. Mice exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atf7 A G 15: 102,442,670 (GRCm39) S480P probably benign Het
Cdk14 A G 5: 5,245,325 (GRCm39) I166T possibly damaging Het
Cdk5rap2 G T 4: 70,267,393 (GRCm39) F358L probably benign Het
Cplane1 T C 15: 8,223,928 (GRCm39) L897P possibly damaging Het
Cytip A G 2: 58,049,986 (GRCm39) S28P probably benign Het
Dennd5b C T 6: 148,946,102 (GRCm39) R503Q probably damaging Het
Dnajc10 T A 2: 80,171,159 (GRCm39) C480S probably damaging Het
Drc7 A G 8: 95,785,711 (GRCm39) D189G probably damaging Het
Engase G A 11: 118,372,121 (GRCm39) V138M probably damaging Het
Esyt3 C A 9: 99,220,840 (GRCm39) R121L probably damaging Het
Frem1 T G 4: 82,858,918 (GRCm39) I1516L probably benign Het
Gatad2b T A 3: 90,258,724 (GRCm39) I249N probably damaging Het
Grk6 T C 13: 55,602,219 (GRCm39) S383P probably benign Het
Hectd1 C T 12: 51,874,134 (GRCm39) probably null Het
Hipk2 A G 6: 38,795,579 (GRCm39) L230P probably damaging Het
Hivep1 A T 13: 42,310,814 (GRCm39) Q1018L probably benign Het
Itgad T C 7: 127,797,550 (GRCm39) F927S probably benign Het
Itgb3bp A G 4: 99,702,335 (GRCm39) V3A probably damaging Het
Kcnh7 G T 2: 62,618,031 (GRCm39) A486D possibly damaging Het
Krt1c T C 15: 101,723,522 (GRCm39) T318A probably benign Het
Ndrg1 A G 15: 66,818,377 (GRCm39) F77S probably damaging Het
Nlrp4c T A 7: 6,068,708 (GRCm39) L203* probably null Het
Nos1 T A 5: 118,085,496 (GRCm39) C1275S probably damaging Het
Or14a256 T C 7: 86,264,900 (GRCm39) S318G probably null Het
Or4a69 A G 2: 89,313,458 (GRCm39) V7A possibly damaging Het
Or5an9 T C 19: 12,187,242 (GRCm39) I104T possibly damaging Het
Or5d39 T C 2: 87,979,716 (GRCm39) T216A possibly damaging Het
Or5j3 T A 2: 86,128,564 (GRCm39) S135T probably benign Het
Or8b12b A T 9: 37,684,437 (GRCm39) N161Y possibly damaging Het
Pip4k2b T C 11: 97,623,542 (GRCm39) M67V possibly damaging Het
Polq C A 16: 36,909,715 (GRCm39) Y2366* probably null Het
Prg3 T C 2: 84,819,097 (GRCm39) S8P probably benign Het
Prl7c1 A T 13: 27,962,952 (GRCm39) L17* probably null Het
Prl8a8 A T 13: 27,695,479 (GRCm39) S51R probably damaging Het
Pttg1 G C 11: 43,311,976 (GRCm39) P160A probably benign Het
Rbfox1 C A 16: 7,170,867 (GRCm39) R276S possibly damaging Het
Rnase2a T G 14: 51,492,988 (GRCm39) M126L probably benign Het
Secisbp2 A T 13: 51,810,943 (GRCm39) K202* probably null Het
Sema6c A G 3: 95,076,156 (GRCm39) H236R possibly damaging Het
Septin12 A G 16: 4,809,857 (GRCm39) L181P probably damaging Het
Shc3 A T 13: 51,585,241 (GRCm39) V458D possibly damaging Het
Tecta A G 9: 42,278,239 (GRCm39) Y1090H probably benign Het
Thsd7a A T 6: 12,379,429 (GRCm39) N998K Het
Tmem131l A T 3: 83,826,766 (GRCm39) S1184T possibly damaging Het
Tnfsf15 T C 4: 63,647,887 (GRCm39) D251G probably damaging Het
Ttyh3 T C 5: 140,615,540 (GRCm39) E348G probably benign Het
Unc5c T C 3: 141,439,665 (GRCm39) L186P probably damaging Het
Vmn2r37 A T 7: 9,219,045 (GRCm39) N446K probably damaging Het
Vmn2r63 T C 7: 42,577,959 (GRCm39) D193G possibly damaging Het
Vmn2r85 A T 10: 130,262,376 (GRCm39) M121K probably benign Het
Vmn2r88 A G 14: 51,651,253 (GRCm39) D189G Het
Vwc2l C A 1: 70,768,252 (GRCm39) C105* probably null Het
Wdr72 T A 9: 74,055,597 (GRCm39) D275E probably damaging Het
Zfhx4 A T 3: 5,467,549 (GRCm39) D2594V probably damaging Het
Zfp174 C T 16: 3,672,269 (GRCm39) H273Y probably benign Het
Zwilch A G 9: 64,068,658 (GRCm39) S203P probably damaging Het
Other mutations in Agbl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Agbl2 APN 2 90,631,389 (GRCm39) missense probably damaging 1.00
IGL00515:Agbl2 APN 2 90,624,304 (GRCm39) missense possibly damaging 0.93
IGL01694:Agbl2 APN 2 90,631,418 (GRCm39) missense probably damaging 1.00
IGL02064:Agbl2 APN 2 90,614,368 (GRCm39) utr 5 prime probably benign
IGL02708:Agbl2 APN 2 90,631,686 (GRCm39) missense probably benign 0.23
IGL02715:Agbl2 APN 2 90,636,212 (GRCm39) missense probably damaging 0.99
IGL02717:Agbl2 APN 2 90,636,212 (GRCm39) missense probably damaging 0.99
IGL02982:Agbl2 APN 2 90,636,159 (GRCm39) missense probably damaging 1.00
IGL03039:Agbl2 APN 2 90,631,566 (GRCm39) missense possibly damaging 0.93
IGL03339:Agbl2 APN 2 90,627,907 (GRCm39) missense probably damaging 1.00
R0243:Agbl2 UTSW 2 90,621,825 (GRCm39) missense possibly damaging 0.80
R0381:Agbl2 UTSW 2 90,614,442 (GRCm39) missense probably damaging 1.00
R0441:Agbl2 UTSW 2 90,627,827 (GRCm39) nonsense probably null
R0549:Agbl2 UTSW 2 90,620,187 (GRCm39) splice site probably benign
R0665:Agbl2 UTSW 2 90,631,554 (GRCm39) missense probably damaging 1.00
R1412:Agbl2 UTSW 2 90,619,298 (GRCm39) missense probably benign
R1682:Agbl2 UTSW 2 90,614,434 (GRCm39) missense probably benign 0.06
R1694:Agbl2 UTSW 2 90,631,664 (GRCm39) missense probably damaging 1.00
R1733:Agbl2 UTSW 2 90,641,089 (GRCm39) missense probably damaging 1.00
R1750:Agbl2 UTSW 2 90,646,720 (GRCm39) utr 3 prime probably benign
R1916:Agbl2 UTSW 2 90,645,785 (GRCm39) missense possibly damaging 0.73
R1940:Agbl2 UTSW 2 90,641,626 (GRCm39) missense probably damaging 0.99
R3115:Agbl2 UTSW 2 90,636,245 (GRCm39) missense possibly damaging 0.85
R3407:Agbl2 UTSW 2 90,621,962 (GRCm39) missense probably damaging 1.00
R3710:Agbl2 UTSW 2 90,636,152 (GRCm39) missense probably benign 0.00
R4227:Agbl2 UTSW 2 90,631,797 (GRCm39) missense probably damaging 0.96
R4719:Agbl2 UTSW 2 90,645,733 (GRCm39) missense probably benign 0.01
R4903:Agbl2 UTSW 2 90,627,817 (GRCm39) missense possibly damaging 0.50
R5170:Agbl2 UTSW 2 90,633,541 (GRCm39) missense probably benign 0.10
R5535:Agbl2 UTSW 2 90,640,350 (GRCm39) missense probably benign 0.26
R5677:Agbl2 UTSW 2 90,638,322 (GRCm39) missense possibly damaging 0.66
R6041:Agbl2 UTSW 2 90,638,371 (GRCm39) missense probably benign 0.00
R6195:Agbl2 UTSW 2 90,643,657 (GRCm39) missense probably benign 0.02
R6233:Agbl2 UTSW 2 90,643,657 (GRCm39) missense probably benign 0.02
R6607:Agbl2 UTSW 2 90,631,670 (GRCm39) missense probably damaging 0.99
R6752:Agbl2 UTSW 2 90,633,418 (GRCm39) missense probably damaging 1.00
R7261:Agbl2 UTSW 2 90,619,288 (GRCm39) missense possibly damaging 0.94
R7555:Agbl2 UTSW 2 90,621,899 (GRCm39) missense probably damaging 1.00
R7704:Agbl2 UTSW 2 90,619,349 (GRCm39) missense probably benign 0.05
R7833:Agbl2 UTSW 2 90,645,777 (GRCm39) missense probably benign 0.00
R7960:Agbl2 UTSW 2 90,621,975 (GRCm39) missense probably benign 0.01
R8070:Agbl2 UTSW 2 90,621,909 (GRCm39) missense probably benign 0.00
R8248:Agbl2 UTSW 2 90,627,908 (GRCm39) missense probably damaging 1.00
R8249:Agbl2 UTSW 2 90,627,908 (GRCm39) missense probably damaging 1.00
R8250:Agbl2 UTSW 2 90,627,908 (GRCm39) missense probably damaging 1.00
R8486:Agbl2 UTSW 2 90,631,499 (GRCm39) missense possibly damaging 0.61
R8501:Agbl2 UTSW 2 90,627,908 (GRCm39) missense probably damaging 1.00
R8856:Agbl2 UTSW 2 90,632,088 (GRCm39) missense probably damaging 1.00
R9039:Agbl2 UTSW 2 90,645,730 (GRCm39) missense probably benign 0.00
R9475:Agbl2 UTSW 2 90,614,437 (GRCm39) missense probably benign 0.00
R9513:Agbl2 UTSW 2 90,631,458 (GRCm39) missense possibly damaging 0.60
R9580:Agbl2 UTSW 2 90,636,248 (GRCm39) missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- ACTTGCTGAGTGAATGCATTCTG -3'
(R):5'- CGGATCCAACTTTTAAGTGATCTC -3'

Sequencing Primer
(F):5'- CATTCTGAGTGGAGCATTAGCCTC -3'
(R):5'- TGATTCCTGGAGTCGTTC -3'
Posted On 2019-05-15