Incidental Mutation 'R7104:Tmem131l'
ID 551038
Institutional Source Beutler Lab
Gene Symbol Tmem131l
Ensembl Gene ENSMUSG00000033767
Gene Name transmembrane 131 like
Synonyms D930015E06Rik
MMRRC Submission 045196-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.138) question?
Stock # R7104 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 83804962-83947482 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 83826766 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 1184 (S1184T)
Ref Sequence ENSEMBL: ENSMUSP00000141438 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052342] [ENSMUST00000191758] [ENSMUST00000192095]
AlphaFold Q3U3D7
Predicted Effect possibly damaging
Transcript: ENSMUST00000052342
AA Change: S1184T

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000049808
Gene: ENSMUSG00000033767
AA Change: S1184T

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
Pfam:TMEM131_like 91 174 5.8e-20 PFAM
low complexity region 464 477 N/A INTRINSIC
low complexity region 612 630 N/A INTRINSIC
low complexity region 904 917 N/A INTRINSIC
low complexity region 990 997 N/A INTRINSIC
low complexity region 1221 1239 N/A INTRINSIC
low complexity region 1291 1324 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000191758
AA Change: S1184T

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000141438
Gene: ENSMUSG00000033767
AA Change: S1184T

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
Pfam:DUF3651 155 228 9.2e-10 PFAM
Pfam:DUF3651 285 362 1.5e-9 PFAM
low complexity region 464 477 N/A INTRINSIC
low complexity region 612 630 N/A INTRINSIC
low complexity region 904 917 N/A INTRINSIC
low complexity region 990 997 N/A INTRINSIC
low complexity region 1221 1239 N/A INTRINSIC
low complexity region 1291 1324 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000192095
AA Change: S1183T

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000141607
Gene: ENSMUSG00000033767
AA Change: S1183T

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
Pfam:DUF3651 155 228 8.8e-10 PFAM
Pfam:DUF3651 285 362 1.4e-9 PFAM
low complexity region 464 477 N/A INTRINSIC
low complexity region 612 630 N/A INTRINSIC
low complexity region 904 917 N/A INTRINSIC
low complexity region 989 996 N/A INTRINSIC
low complexity region 1220 1238 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl2 A G 2: 90,627,891 (GRCm39) E232G probably damaging Het
Atf7 A G 15: 102,442,670 (GRCm39) S480P probably benign Het
Cdk14 A G 5: 5,245,325 (GRCm39) I166T possibly damaging Het
Cdk5rap2 G T 4: 70,267,393 (GRCm39) F358L probably benign Het
Cplane1 T C 15: 8,223,928 (GRCm39) L897P possibly damaging Het
Cytip A G 2: 58,049,986 (GRCm39) S28P probably benign Het
Dennd5b C T 6: 148,946,102 (GRCm39) R503Q probably damaging Het
Dnajc10 T A 2: 80,171,159 (GRCm39) C480S probably damaging Het
Drc7 A G 8: 95,785,711 (GRCm39) D189G probably damaging Het
Engase G A 11: 118,372,121 (GRCm39) V138M probably damaging Het
Esyt3 C A 9: 99,220,840 (GRCm39) R121L probably damaging Het
Frem1 T G 4: 82,858,918 (GRCm39) I1516L probably benign Het
Gatad2b T A 3: 90,258,724 (GRCm39) I249N probably damaging Het
Grk6 T C 13: 55,602,219 (GRCm39) S383P probably benign Het
Hectd1 C T 12: 51,874,134 (GRCm39) probably null Het
Hipk2 A G 6: 38,795,579 (GRCm39) L230P probably damaging Het
Hivep1 A T 13: 42,310,814 (GRCm39) Q1018L probably benign Het
Itgad T C 7: 127,797,550 (GRCm39) F927S probably benign Het
Itgb3bp A G 4: 99,702,335 (GRCm39) V3A probably damaging Het
Kcnh7 G T 2: 62,618,031 (GRCm39) A486D possibly damaging Het
Krt1c T C 15: 101,723,522 (GRCm39) T318A probably benign Het
Ndrg1 A G 15: 66,818,377 (GRCm39) F77S probably damaging Het
Nlrp4c T A 7: 6,068,708 (GRCm39) L203* probably null Het
Nos1 T A 5: 118,085,496 (GRCm39) C1275S probably damaging Het
Or14a256 T C 7: 86,264,900 (GRCm39) S318G probably null Het
Or4a69 A G 2: 89,313,458 (GRCm39) V7A possibly damaging Het
Or5an9 T C 19: 12,187,242 (GRCm39) I104T possibly damaging Het
Or5d39 T C 2: 87,979,716 (GRCm39) T216A possibly damaging Het
Or5j3 T A 2: 86,128,564 (GRCm39) S135T probably benign Het
Or8b12b A T 9: 37,684,437 (GRCm39) N161Y possibly damaging Het
Pip4k2b T C 11: 97,623,542 (GRCm39) M67V possibly damaging Het
Polq C A 16: 36,909,715 (GRCm39) Y2366* probably null Het
Prg3 T C 2: 84,819,097 (GRCm39) S8P probably benign Het
Prl7c1 A T 13: 27,962,952 (GRCm39) L17* probably null Het
Prl8a8 A T 13: 27,695,479 (GRCm39) S51R probably damaging Het
Pttg1 G C 11: 43,311,976 (GRCm39) P160A probably benign Het
Rbfox1 C A 16: 7,170,867 (GRCm39) R276S possibly damaging Het
Rnase2a T G 14: 51,492,988 (GRCm39) M126L probably benign Het
Secisbp2 A T 13: 51,810,943 (GRCm39) K202* probably null Het
Sema6c A G 3: 95,076,156 (GRCm39) H236R possibly damaging Het
Septin12 A G 16: 4,809,857 (GRCm39) L181P probably damaging Het
Shc3 A T 13: 51,585,241 (GRCm39) V458D possibly damaging Het
Tecta A G 9: 42,278,239 (GRCm39) Y1090H probably benign Het
Thsd7a A T 6: 12,379,429 (GRCm39) N998K Het
Tnfsf15 T C 4: 63,647,887 (GRCm39) D251G probably damaging Het
Ttyh3 T C 5: 140,615,540 (GRCm39) E348G probably benign Het
Unc5c T C 3: 141,439,665 (GRCm39) L186P probably damaging Het
Vmn2r37 A T 7: 9,219,045 (GRCm39) N446K probably damaging Het
Vmn2r63 T C 7: 42,577,959 (GRCm39) D193G possibly damaging Het
Vmn2r85 A T 10: 130,262,376 (GRCm39) M121K probably benign Het
Vmn2r88 A G 14: 51,651,253 (GRCm39) D189G Het
Vwc2l C A 1: 70,768,252 (GRCm39) C105* probably null Het
Wdr72 T A 9: 74,055,597 (GRCm39) D275E probably damaging Het
Zfhx4 A T 3: 5,467,549 (GRCm39) D2594V probably damaging Het
Zfp174 C T 16: 3,672,269 (GRCm39) H273Y probably benign Het
Zwilch A G 9: 64,068,658 (GRCm39) S203P probably damaging Het
Other mutations in Tmem131l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Tmem131l APN 3 83,849,807 (GRCm39) missense probably damaging 0.99
IGL00777:Tmem131l APN 3 83,806,597 (GRCm39) missense probably damaging 1.00
IGL01400:Tmem131l APN 3 83,829,429 (GRCm39) missense probably damaging 0.99
IGL01642:Tmem131l APN 3 83,845,357 (GRCm39) missense possibly damaging 0.63
IGL01796:Tmem131l APN 3 83,845,362 (GRCm39) nonsense probably null
IGL02055:Tmem131l APN 3 83,817,673 (GRCm39) splice site probably null
IGL02269:Tmem131l APN 3 83,845,357 (GRCm39) missense possibly damaging 0.63
IGL02806:Tmem131l APN 3 83,836,123 (GRCm39) splice site probably benign
IGL03308:Tmem131l APN 3 83,848,209 (GRCm39) missense probably benign 0.00
IGL03345:Tmem131l APN 3 83,868,896 (GRCm39) missense probably damaging 1.00
R0106:Tmem131l UTSW 3 83,842,122 (GRCm39) splice site probably benign
R0112:Tmem131l UTSW 3 83,847,894 (GRCm39) nonsense probably null
R0212:Tmem131l UTSW 3 83,820,575 (GRCm39) missense probably benign 0.19
R0328:Tmem131l UTSW 3 83,829,238 (GRCm39) splice site probably benign
R0412:Tmem131l UTSW 3 83,938,955 (GRCm39) missense probably damaging 1.00
R0544:Tmem131l UTSW 3 83,805,853 (GRCm39) missense probably damaging 1.00
R0676:Tmem131l UTSW 3 83,842,122 (GRCm39) splice site probably benign
R0815:Tmem131l UTSW 3 83,847,879 (GRCm39) missense probably benign 0.01
R0826:Tmem131l UTSW 3 83,805,724 (GRCm39) missense probably damaging 1.00
R1432:Tmem131l UTSW 3 83,836,021 (GRCm39) missense probably damaging 1.00
R1582:Tmem131l UTSW 3 83,839,090 (GRCm39) missense probably damaging 0.99
R1591:Tmem131l UTSW 3 83,848,196 (GRCm39) critical splice donor site probably null
R1804:Tmem131l UTSW 3 83,817,786 (GRCm39) missense possibly damaging 0.72
R1875:Tmem131l UTSW 3 83,812,383 (GRCm39) nonsense probably null
R1955:Tmem131l UTSW 3 83,868,851 (GRCm39) missense probably damaging 1.00
R2049:Tmem131l UTSW 3 83,850,095 (GRCm39) missense probably damaging 1.00
R2125:Tmem131l UTSW 3 83,850,058 (GRCm39) critical splice donor site probably null
R2173:Tmem131l UTSW 3 83,833,452 (GRCm39) missense probably damaging 1.00
R2321:Tmem131l UTSW 3 83,843,330 (GRCm39) missense probably damaging 0.98
R2407:Tmem131l UTSW 3 83,829,355 (GRCm39) missense probably benign 0.25
R2917:Tmem131l UTSW 3 83,844,887 (GRCm39) nonsense probably null
R3082:Tmem131l UTSW 3 83,816,457 (GRCm39) critical splice donor site probably null
R3086:Tmem131l UTSW 3 83,839,046 (GRCm39) missense probably benign 0.00
R3773:Tmem131l UTSW 3 83,805,893 (GRCm39) missense probably damaging 1.00
R3921:Tmem131l UTSW 3 83,847,908 (GRCm39) missense possibly damaging 0.68
R3953:Tmem131l UTSW 3 83,817,726 (GRCm39) missense probably damaging 1.00
R3954:Tmem131l UTSW 3 83,817,726 (GRCm39) missense probably damaging 1.00
R3956:Tmem131l UTSW 3 83,817,726 (GRCm39) missense probably damaging 1.00
R4118:Tmem131l UTSW 3 83,868,074 (GRCm39) missense probably benign 0.00
R4700:Tmem131l UTSW 3 83,806,519 (GRCm39) missense probably benign
R4862:Tmem131l UTSW 3 83,805,517 (GRCm39) splice site probably benign
R4941:Tmem131l UTSW 3 83,806,546 (GRCm39) missense probably benign 0.03
R5101:Tmem131l UTSW 3 83,844,811 (GRCm39) missense probably damaging 0.96
R5290:Tmem131l UTSW 3 83,806,572 (GRCm39) missense probably benign 0.30
R5501:Tmem131l UTSW 3 83,833,435 (GRCm39) missense probably damaging 1.00
R5813:Tmem131l UTSW 3 83,847,879 (GRCm39) missense probably benign 0.01
R5845:Tmem131l UTSW 3 83,847,860 (GRCm39) missense probably damaging 0.99
R5973:Tmem131l UTSW 3 83,829,553 (GRCm39) missense possibly damaging 0.95
R6119:Tmem131l UTSW 3 83,805,689 (GRCm39) missense probably damaging 1.00
R6241:Tmem131l UTSW 3 83,829,471 (GRCm39) missense probably benign 0.06
R6278:Tmem131l UTSW 3 83,849,798 (GRCm39) missense possibly damaging 0.93
R6490:Tmem131l UTSW 3 83,820,587 (GRCm39) missense possibly damaging 0.67
R6502:Tmem131l UTSW 3 83,829,715 (GRCm39) missense probably damaging 1.00
R6503:Tmem131l UTSW 3 83,848,251 (GRCm39) missense probably benign 0.26
R6868:Tmem131l UTSW 3 83,868,938 (GRCm39) missense probably damaging 0.99
R7736:Tmem131l UTSW 3 83,847,875 (GRCm39) missense probably damaging 0.97
R7885:Tmem131l UTSW 3 83,817,724 (GRCm39) missense possibly damaging 0.89
R8085:Tmem131l UTSW 3 83,834,438 (GRCm39) missense possibly damaging 0.81
R8164:Tmem131l UTSW 3 83,833,495 (GRCm39) nonsense probably null
R8478:Tmem131l UTSW 3 83,805,769 (GRCm39) missense probably damaging 0.99
R8677:Tmem131l UTSW 3 83,836,009 (GRCm39) missense probably damaging 1.00
R8942:Tmem131l UTSW 3 83,805,793 (GRCm39) missense possibly damaging 0.66
R8943:Tmem131l UTSW 3 83,831,479 (GRCm39) missense probably damaging 1.00
R8973:Tmem131l UTSW 3 83,836,039 (GRCm39) missense probably damaging 1.00
R9068:Tmem131l UTSW 3 83,817,775 (GRCm39) missense probably benign 0.05
R9096:Tmem131l UTSW 3 83,850,122 (GRCm39) missense probably damaging 1.00
R9097:Tmem131l UTSW 3 83,850,122 (GRCm39) missense probably damaging 1.00
R9143:Tmem131l UTSW 3 83,842,220 (GRCm39) missense probably benign 0.14
R9273:Tmem131l UTSW 3 83,848,244 (GRCm39) missense probably damaging 1.00
R9325:Tmem131l UTSW 3 83,817,768 (GRCm39) missense probably benign 0.00
R9400:Tmem131l UTSW 3 83,830,293 (GRCm39) missense possibly damaging 0.68
R9433:Tmem131l UTSW 3 83,845,459 (GRCm39) missense probably benign 0.14
R9574:Tmem131l UTSW 3 83,868,911 (GRCm39) missense probably damaging 1.00
R9647:Tmem131l UTSW 3 83,836,018 (GRCm39) missense probably damaging 1.00
R9750:Tmem131l UTSW 3 83,831,358 (GRCm39) missense probably damaging 1.00
R9796:Tmem131l UTSW 3 83,829,402 (GRCm39) missense probably damaging 0.99
Z1177:Tmem131l UTSW 3 83,947,400 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGAAGGTAAAGCTTGCTGAG -3'
(R):5'- AAGTCAGTTTCTGGAGAATCGTG -3'

Sequencing Primer
(F):5'- GCTGAGCAATCATATCACACCTTTG -3'
(R):5'- TACGAATGGAAGAGTACTAGAAACTG -3'
Posted On 2019-05-15