Incidental Mutation 'R7104:Frem1'
ID 551044
Institutional Source Beutler Lab
Gene Symbol Frem1
Ensembl Gene ENSMUSG00000059049
Gene Name Fras1 related extracellular matrix protein 1
Synonyms eyes2, crf11, eye, QBRICK, heb
MMRRC Submission 045196-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.712) question?
Stock # R7104 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 82816157-82970576 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 82858918 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 1516 (I1516L)
Ref Sequence ENSEMBL: ENSMUSP00000071627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071708] [ENSMUST00000107230] [ENSMUST00000170248]
AlphaFold Q684R7
Predicted Effect probably benign
Transcript: ENSMUST00000071708
AA Change: I1516L

PolyPhen 2 Score 0.303 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000071627
Gene: ENSMUSG00000059049
AA Change: I1516L

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Cadherin_3 364 508 1.7e-37 PFAM
Pfam:Cadherin_3 509 623 3.7e-18 PFAM
Pfam:Cadherin_3 592 709 8.4e-16 PFAM
Pfam:Cadherin_3 746 894 4.8e-26 PFAM
Pfam:Cadherin_3 863 1009 2.8e-30 PFAM
Pfam:Cadherin_3 1024 1115 6.4e-13 PFAM
Pfam:Cadherin_3 1119 1252 1.4e-17 PFAM
Pfam:Cadherin_3 1243 1393 8.2e-35 PFAM
Pfam:Cadherin_3 1378 1506 2e-22 PFAM
Pfam:Cadherin_3 1506 1616 1e-29 PFAM
Pfam:Cadherin_3 1617 1744 1.5e-14 PFAM
Pfam:Calx-beta 1749 1848 2.6e-10 PFAM
low complexity region 1894 1910 N/A INTRINSIC
CLECT 2065 2188 2.25e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107230
AA Change: I1497L

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000102849
Gene: ENSMUSG00000059049
AA Change: I1497L

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
internal_repeat_1 296 967 9.01e-39 PROSPERO
internal_repeat_1 1026 1705 9.01e-39 PROSPERO
Pfam:Calx-beta 1730 1829 6.7e-10 PFAM
low complexity region 1875 1891 N/A INTRINSIC
CLECT 2046 2169 2.25e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127886
SMART Domains Protein: ENSMUSP00000122467
Gene: ENSMUSG00000059049

DomainStartEndE-ValueType
Pfam:Cadherin_3 26 158 1.1e-18 PFAM
Pfam:Cadherin_3 150 300 4.6e-36 PFAM
Pfam:Cadherin_3 285 408 6e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170248
AA Change: I1498L

PolyPhen 2 Score 0.303 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000125809
Gene: ENSMUSG00000059049
AA Change: I1498L

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Cadherin_3 365 509 1.3e-37 PFAM
Pfam:Cadherin_3 510 623 4.5e-18 PFAM
Pfam:Cadherin_3 593 711 6.1e-16 PFAM
Pfam:Cadherin_3 728 876 2.7e-27 PFAM
Pfam:Cadherin_3 845 991 2.1e-30 PFAM
Pfam:Cadherin_3 1006 1097 4.8e-13 PFAM
Pfam:Cadherin_3 1101 1234 1e-17 PFAM
Pfam:Cadherin_3 1225 1375 6.1e-35 PFAM
Pfam:Cadherin_3 1360 1488 1.5e-22 PFAM
Pfam:Cadherin_3 1488 1598 7.5e-30 PFAM
Pfam:Cadherin_3 1599 1726 1.1e-14 PFAM
Pfam:Calx-beta 1731 1830 6.4e-10 PFAM
low complexity region 1876 1892 N/A INTRINSIC
CLECT 2047 2170 2.25e-27 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a basement membrane protein that may play a role in craniofacial and renal development. Mutations in this gene have been associated with bifid nose with or without anorectal and renal anomalies. Alternatively spliced transcript variants encoding different isoforms have been described. PubMed ID 19940113 describes one such variant that initiates transcription within a distinct, internal exon; the resulting shorter isoform (named Toll-like/interleukin-1 receptor regulator, TILRR) is suggested to be a co-receptor of the interleukin 1 receptor family and may regulate receptor function and Toll-like receptor/interleukin 1 receptor signal transduction, contributing to the control of inflammatory response activation. [provided by RefSeq, Apr 2011]
PHENOTYPE: Homozygous mutation of this gene results in subepidermal blistering, cryptophthalmos, syndactyly, and renal agenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl2 A G 2: 90,627,891 (GRCm39) E232G probably damaging Het
Atf7 A G 15: 102,442,670 (GRCm39) S480P probably benign Het
Cdk14 A G 5: 5,245,325 (GRCm39) I166T possibly damaging Het
Cdk5rap2 G T 4: 70,267,393 (GRCm39) F358L probably benign Het
Cplane1 T C 15: 8,223,928 (GRCm39) L897P possibly damaging Het
Cytip A G 2: 58,049,986 (GRCm39) S28P probably benign Het
Dennd5b C T 6: 148,946,102 (GRCm39) R503Q probably damaging Het
Dnajc10 T A 2: 80,171,159 (GRCm39) C480S probably damaging Het
Drc7 A G 8: 95,785,711 (GRCm39) D189G probably damaging Het
Engase G A 11: 118,372,121 (GRCm39) V138M probably damaging Het
Esyt3 C A 9: 99,220,840 (GRCm39) R121L probably damaging Het
Gatad2b T A 3: 90,258,724 (GRCm39) I249N probably damaging Het
Grk6 T C 13: 55,602,219 (GRCm39) S383P probably benign Het
Hectd1 C T 12: 51,874,134 (GRCm39) probably null Het
Hipk2 A G 6: 38,795,579 (GRCm39) L230P probably damaging Het
Hivep1 A T 13: 42,310,814 (GRCm39) Q1018L probably benign Het
Itgad T C 7: 127,797,550 (GRCm39) F927S probably benign Het
Itgb3bp A G 4: 99,702,335 (GRCm39) V3A probably damaging Het
Kcnh7 G T 2: 62,618,031 (GRCm39) A486D possibly damaging Het
Krt1c T C 15: 101,723,522 (GRCm39) T318A probably benign Het
Ndrg1 A G 15: 66,818,377 (GRCm39) F77S probably damaging Het
Nlrp4c T A 7: 6,068,708 (GRCm39) L203* probably null Het
Nos1 T A 5: 118,085,496 (GRCm39) C1275S probably damaging Het
Or14a256 T C 7: 86,264,900 (GRCm39) S318G probably null Het
Or4a69 A G 2: 89,313,458 (GRCm39) V7A possibly damaging Het
Or5an9 T C 19: 12,187,242 (GRCm39) I104T possibly damaging Het
Or5d39 T C 2: 87,979,716 (GRCm39) T216A possibly damaging Het
Or5j3 T A 2: 86,128,564 (GRCm39) S135T probably benign Het
Or8b12b A T 9: 37,684,437 (GRCm39) N161Y possibly damaging Het
Pip4k2b T C 11: 97,623,542 (GRCm39) M67V possibly damaging Het
Polq C A 16: 36,909,715 (GRCm39) Y2366* probably null Het
Prg3 T C 2: 84,819,097 (GRCm39) S8P probably benign Het
Prl7c1 A T 13: 27,962,952 (GRCm39) L17* probably null Het
Prl8a8 A T 13: 27,695,479 (GRCm39) S51R probably damaging Het
Pttg1 G C 11: 43,311,976 (GRCm39) P160A probably benign Het
Rbfox1 C A 16: 7,170,867 (GRCm39) R276S possibly damaging Het
Rnase2a T G 14: 51,492,988 (GRCm39) M126L probably benign Het
Secisbp2 A T 13: 51,810,943 (GRCm39) K202* probably null Het
Sema6c A G 3: 95,076,156 (GRCm39) H236R possibly damaging Het
Septin12 A G 16: 4,809,857 (GRCm39) L181P probably damaging Het
Shc3 A T 13: 51,585,241 (GRCm39) V458D possibly damaging Het
Tecta A G 9: 42,278,239 (GRCm39) Y1090H probably benign Het
Thsd7a A T 6: 12,379,429 (GRCm39) N998K Het
Tmem131l A T 3: 83,826,766 (GRCm39) S1184T possibly damaging Het
Tnfsf15 T C 4: 63,647,887 (GRCm39) D251G probably damaging Het
Ttyh3 T C 5: 140,615,540 (GRCm39) E348G probably benign Het
Unc5c T C 3: 141,439,665 (GRCm39) L186P probably damaging Het
Vmn2r37 A T 7: 9,219,045 (GRCm39) N446K probably damaging Het
Vmn2r63 T C 7: 42,577,959 (GRCm39) D193G possibly damaging Het
Vmn2r85 A T 10: 130,262,376 (GRCm39) M121K probably benign Het
Vmn2r88 A G 14: 51,651,253 (GRCm39) D189G Het
Vwc2l C A 1: 70,768,252 (GRCm39) C105* probably null Het
Wdr72 T A 9: 74,055,597 (GRCm39) D275E probably damaging Het
Zfhx4 A T 3: 5,467,549 (GRCm39) D2594V probably damaging Het
Zfp174 C T 16: 3,672,269 (GRCm39) H273Y probably benign Het
Zwilch A G 9: 64,068,658 (GRCm39) S203P probably damaging Het
Other mutations in Frem1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Frem1 APN 4 82,877,626 (GRCm39) missense possibly damaging 0.46
IGL01069:Frem1 APN 4 82,932,104 (GRCm39) missense probably benign 0.00
IGL01106:Frem1 APN 4 82,840,494 (GRCm39) missense probably benign 0.00
IGL01398:Frem1 APN 4 82,868,599 (GRCm39) missense possibly damaging 0.64
IGL01617:Frem1 APN 4 82,854,376 (GRCm39) missense probably benign 0.02
IGL01647:Frem1 APN 4 82,868,593 (GRCm39) missense possibly damaging 0.60
IGL01690:Frem1 APN 4 82,877,533 (GRCm39) splice site probably benign
IGL02006:Frem1 APN 4 82,911,037 (GRCm39) critical splice donor site probably null
IGL02069:Frem1 APN 4 82,821,788 (GRCm39) missense probably damaging 1.00
IGL02131:Frem1 APN 4 82,843,091 (GRCm39) missense probably benign 0.03
IGL02225:Frem1 APN 4 82,858,743 (GRCm39) missense probably damaging 1.00
IGL02439:Frem1 APN 4 82,874,582 (GRCm39) missense probably benign 0.00
IGL02567:Frem1 APN 4 82,918,292 (GRCm39) missense probably damaging 1.00
IGL02647:Frem1 APN 4 82,919,991 (GRCm39) missense probably damaging 1.00
IGL02653:Frem1 APN 4 82,877,571 (GRCm39) missense probably benign 0.22
IGL02831:Frem1 APN 4 82,874,395 (GRCm39) missense probably benign 0.31
IGL02997:Frem1 APN 4 82,853,205 (GRCm39) missense probably damaging 1.00
IGL03005:Frem1 APN 4 82,912,371 (GRCm39) missense probably damaging 1.00
IGL03036:Frem1 APN 4 82,877,576 (GRCm39) missense possibly damaging 0.55
IGL03193:Frem1 APN 4 82,912,263 (GRCm39) splice site probably benign
IGL03218:Frem1 APN 4 82,832,883 (GRCm39) missense probably benign 0.00
IGL03235:Frem1 APN 4 82,938,992 (GRCm39) missense possibly damaging 0.87
IGL03243:Frem1 APN 4 82,932,206 (GRCm39) missense probably damaging 1.00
bat UTSW 4 82,983,060 (GRCm38) intron probably benign
blister UTSW 4 82,939,007 (GRCm39) missense probably benign 0.28
boy UTSW 4 82,874,492 (GRCm39) missense probably benign 0.16
Bubblie UTSW 4 82,888,870 (GRCm39) critical splice donor site probably null
magicbear UTSW 4 82,920,057 (GRCm39) missense probably damaging 1.00
major UTSW 4 82,907,426 (GRCm39) missense probably damaging 1.00
R6324_Frem1_643 UTSW 4 82,901,574 (GRCm39) missense probably benign 0.00
PIT4131001:Frem1 UTSW 4 82,924,045 (GRCm39) missense probably damaging 0.99
PIT4466001:Frem1 UTSW 4 82,890,374 (GRCm39) missense probably benign 0.01
PIT4472001:Frem1 UTSW 4 82,890,374 (GRCm39) missense probably benign 0.01
PIT4515001:Frem1 UTSW 4 82,818,663 (GRCm39) missense probably damaging 0.98
PIT4531001:Frem1 UTSW 4 82,868,517 (GRCm39) missense probably benign 0.12
R0010:Frem1 UTSW 4 82,918,335 (GRCm39) missense probably benign 0.41
R0010:Frem1 UTSW 4 82,918,335 (GRCm39) missense probably benign 0.41
R0115:Frem1 UTSW 4 82,854,406 (GRCm39) missense possibly damaging 0.94
R0125:Frem1 UTSW 4 82,930,188 (GRCm39) missense probably damaging 1.00
R0280:Frem1 UTSW 4 82,887,681 (GRCm39) missense probably damaging 1.00
R0504:Frem1 UTSW 4 82,830,874 (GRCm39) missense probably benign 0.26
R0519:Frem1 UTSW 4 82,888,870 (GRCm39) critical splice donor site probably null
R0631:Frem1 UTSW 4 82,890,402 (GRCm39) missense probably damaging 1.00
R0645:Frem1 UTSW 4 82,907,403 (GRCm39) missense probably damaging 1.00
R0781:Frem1 UTSW 4 82,868,557 (GRCm39) missense probably damaging 0.99
R1110:Frem1 UTSW 4 82,868,557 (GRCm39) missense probably damaging 0.99
R1115:Frem1 UTSW 4 82,939,007 (GRCm39) missense probably benign 0.28
R1130:Frem1 UTSW 4 82,834,865 (GRCm39) splice site probably null
R1173:Frem1 UTSW 4 82,868,589 (GRCm39) missense probably benign 0.16
R1349:Frem1 UTSW 4 82,840,542 (GRCm39) splice site probably benign
R1464:Frem1 UTSW 4 82,930,116 (GRCm39) missense probably damaging 1.00
R1464:Frem1 UTSW 4 82,930,116 (GRCm39) missense probably damaging 1.00
R1658:Frem1 UTSW 4 82,920,045 (GRCm39) missense probably damaging 1.00
R1672:Frem1 UTSW 4 82,917,128 (GRCm39) missense probably benign 0.09
R1831:Frem1 UTSW 4 82,939,074 (GRCm39) missense possibly damaging 0.95
R1851:Frem1 UTSW 4 82,868,737 (GRCm39) missense probably damaging 0.98
R2014:Frem1 UTSW 4 82,924,089 (GRCm39) missense probably damaging 1.00
R2021:Frem1 UTSW 4 82,831,795 (GRCm39) missense probably benign 0.02
R2022:Frem1 UTSW 4 82,831,795 (GRCm39) missense probably benign 0.02
R2023:Frem1 UTSW 4 82,831,795 (GRCm39) missense probably benign 0.02
R2183:Frem1 UTSW 4 82,909,732 (GRCm39) missense probably benign 0.00
R2437:Frem1 UTSW 4 82,918,410 (GRCm39) missense probably damaging 1.00
R2520:Frem1 UTSW 4 82,868,527 (GRCm39) missense probably damaging 0.99
R3195:Frem1 UTSW 4 82,932,351 (GRCm39) missense probably damaging 0.99
R3196:Frem1 UTSW 4 82,932,351 (GRCm39) missense probably damaging 0.99
R3408:Frem1 UTSW 4 82,930,223 (GRCm39) missense probably damaging 1.00
R3411:Frem1 UTSW 4 82,881,416 (GRCm39) missense possibly damaging 0.51
R3742:Frem1 UTSW 4 82,930,104 (GRCm39) missense probably damaging 1.00
R3829:Frem1 UTSW 4 82,917,167 (GRCm39) missense probably damaging 1.00
R3888:Frem1 UTSW 4 82,831,844 (GRCm39) missense probably benign 0.41
R4329:Frem1 UTSW 4 82,904,774 (GRCm39) missense probably benign 0.01
R4364:Frem1 UTSW 4 82,831,488 (GRCm39) missense probably damaging 0.99
R4411:Frem1 UTSW 4 82,881,481 (GRCm39) missense probably damaging 1.00
R4624:Frem1 UTSW 4 82,907,343 (GRCm39) missense probably damaging 1.00
R4687:Frem1 UTSW 4 82,938,868 (GRCm39) missense probably damaging 1.00
R4764:Frem1 UTSW 4 82,907,426 (GRCm39) missense probably damaging 1.00
R4801:Frem1 UTSW 4 82,834,865 (GRCm39) splice site probably benign
R4802:Frem1 UTSW 4 82,834,865 (GRCm39) splice site probably benign
R4854:Frem1 UTSW 4 82,834,995 (GRCm39) missense possibly damaging 0.88
R4872:Frem1 UTSW 4 82,881,387 (GRCm39) missense probably damaging 1.00
R4947:Frem1 UTSW 4 82,884,371 (GRCm39) missense probably damaging 0.99
R5007:Frem1 UTSW 4 82,859,049 (GRCm39) intron probably benign
R5103:Frem1 UTSW 4 82,909,849 (GRCm39) missense probably benign
R5369:Frem1 UTSW 4 82,919,976 (GRCm39) missense possibly damaging 0.61
R5494:Frem1 UTSW 4 82,858,990 (GRCm39) makesense probably null
R5694:Frem1 UTSW 4 82,912,353 (GRCm39) missense probably damaging 1.00
R5780:Frem1 UTSW 4 82,868,652 (GRCm39) missense probably benign 0.12
R5813:Frem1 UTSW 4 82,918,395 (GRCm39) missense probably damaging 1.00
R5843:Frem1 UTSW 4 82,854,289 (GRCm39) missense probably damaging 1.00
R5914:Frem1 UTSW 4 82,920,012 (GRCm39) missense probably damaging 1.00
R5985:Frem1 UTSW 4 82,884,287 (GRCm39) missense probably benign
R6091:Frem1 UTSW 4 82,818,796 (GRCm39) missense probably benign 0.01
R6165:Frem1 UTSW 4 82,874,492 (GRCm39) missense probably benign 0.16
R6324:Frem1 UTSW 4 82,901,574 (GRCm39) missense probably benign 0.00
R6369:Frem1 UTSW 4 82,832,029 (GRCm39) splice site probably null
R6414:Frem1 UTSW 4 82,858,773 (GRCm39) missense probably damaging 0.98
R6421:Frem1 UTSW 4 82,912,365 (GRCm39) missense probably damaging 1.00
R6434:Frem1 UTSW 4 82,884,253 (GRCm39) missense probably benign 0.03
R6453:Frem1 UTSW 4 82,833,062 (GRCm39) nonsense probably null
R6598:Frem1 UTSW 4 82,932,065 (GRCm39) missense probably damaging 0.99
R6720:Frem1 UTSW 4 82,932,069 (GRCm39) missense probably damaging 0.98
R6862:Frem1 UTSW 4 82,930,251 (GRCm39) nonsense probably null
R6922:Frem1 UTSW 4 82,840,506 (GRCm39) missense probably damaging 1.00
R6931:Frem1 UTSW 4 82,888,914 (GRCm39) missense probably damaging 1.00
R6992:Frem1 UTSW 4 82,858,599 (GRCm39) missense possibly damaging 0.62
R6995:Frem1 UTSW 4 82,904,838 (GRCm39) missense probably damaging 1.00
R7001:Frem1 UTSW 4 82,904,798 (GRCm39) missense probably benign 0.44
R7146:Frem1 UTSW 4 82,840,532 (GRCm39) missense possibly damaging 0.93
R7174:Frem1 UTSW 4 82,840,493 (GRCm39) missense probably benign 0.00
R7327:Frem1 UTSW 4 82,938,992 (GRCm39) missense possibly damaging 0.87
R7343:Frem1 UTSW 4 82,912,359 (GRCm39) missense probably damaging 0.99
R7368:Frem1 UTSW 4 82,884,381 (GRCm39) missense probably benign 0.19
R7392:Frem1 UTSW 4 82,932,064 (GRCm39) missense probably benign 0.06
R7465:Frem1 UTSW 4 82,833,072 (GRCm39) missense probably benign 0.11
R7499:Frem1 UTSW 4 82,924,007 (GRCm39) missense probably damaging 1.00
R7536:Frem1 UTSW 4 82,874,432 (GRCm39) missense probably damaging 1.00
R7752:Frem1 UTSW 4 82,877,614 (GRCm39) missense probably benign 0.02
R7753:Frem1 UTSW 4 82,832,217 (GRCm39) missense probably benign 0.03
R7790:Frem1 UTSW 4 82,907,401 (GRCm39) missense probably benign 0.02
R7818:Frem1 UTSW 4 82,932,245 (GRCm39) missense probably damaging 1.00
R7877:Frem1 UTSW 4 82,932,049 (GRCm39) critical splice donor site probably null
R7878:Frem1 UTSW 4 82,938,917 (GRCm39) missense probably benign 0.00
R7886:Frem1 UTSW 4 82,934,643 (GRCm39) missense possibly damaging 0.68
R7901:Frem1 UTSW 4 82,877,614 (GRCm39) missense probably benign 0.02
R7976:Frem1 UTSW 4 82,919,946 (GRCm39) missense probably damaging 0.97
R8240:Frem1 UTSW 4 82,874,485 (GRCm39) missense probably benign 0.21
R8305:Frem1 UTSW 4 82,918,226 (GRCm39) missense probably benign 0.06
R8415:Frem1 UTSW 4 82,918,499 (GRCm39) missense probably damaging 1.00
R8751:Frem1 UTSW 4 82,889,015 (GRCm39) missense probably damaging 1.00
R8819:Frem1 UTSW 4 82,821,754 (GRCm39) missense probably damaging 1.00
R8820:Frem1 UTSW 4 82,821,754 (GRCm39) missense probably damaging 1.00
R8829:Frem1 UTSW 4 82,918,431 (GRCm39) missense probably damaging 1.00
R8834:Frem1 UTSW 4 82,922,610 (GRCm39) missense probably damaging 1.00
R8857:Frem1 UTSW 4 82,922,280 (GRCm39) intron probably benign
R8910:Frem1 UTSW 4 82,868,694 (GRCm39) missense probably benign 0.09
R9036:Frem1 UTSW 4 82,831,785 (GRCm39) missense probably benign
R9228:Frem1 UTSW 4 82,920,057 (GRCm39) missense probably damaging 1.00
R9382:Frem1 UTSW 4 82,901,622 (GRCm39) missense possibly damaging 0.79
R9441:Frem1 UTSW 4 82,924,083 (GRCm39) missense probably damaging 1.00
R9492:Frem1 UTSW 4 82,920,057 (GRCm39) missense probably damaging 1.00
R9517:Frem1 UTSW 4 82,901,714 (GRCm39) missense probably damaging 1.00
R9640:Frem1 UTSW 4 82,831,896 (GRCm39) missense probably benign
R9641:Frem1 UTSW 4 82,877,653 (GRCm39) missense probably damaging 1.00
X0013:Frem1 UTSW 4 82,833,045 (GRCm39) missense probably benign 0.38
X0017:Frem1 UTSW 4 82,909,870 (GRCm39) critical splice acceptor site probably null
Z1088:Frem1 UTSW 4 82,890,504 (GRCm39) missense probably damaging 1.00
Z1176:Frem1 UTSW 4 82,918,220 (GRCm39) missense probably damaging 1.00
Z1177:Frem1 UTSW 4 82,918,506 (GRCm39) missense probably benign 0.39
Z1177:Frem1 UTSW 4 82,858,552 (GRCm39) critical splice donor site probably null
Z1177:Frem1 UTSW 4 82,934,701 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCTTTCCCTCTCAGGAAG -3'
(R):5'- GGTTTACTAACAGAAGGATGCTCC -3'

Sequencing Primer
(F):5'- TCTCAGGAAGAGGTACCCGTG -3'
(R):5'- GGATGCTCCTCAGGAATCCC -3'
Posted On 2019-05-15