Incidental Mutation 'R7104:Ttyh3'
ID551048
Institutional Source Beutler Lab
Gene Symbol Ttyh3
Ensembl Gene ENSMUSG00000036565
Gene Nametweety family member 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R7104 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location140620578-140649031 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 140629785 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 348 (E348G)
Ref Sequence ENSEMBL: ENSMUSP00000037447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042661] [ENSMUST00000197452]
Predicted Effect probably benign
Transcript: ENSMUST00000042661
AA Change: E348G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000037447
Gene: ENSMUSG00000036565
AA Change: E348G

DomainStartEndE-ValueType
Pfam:Tweety 25 430 9.4e-183 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197452
AA Change: E348G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000142655
Gene: ENSMUSG00000036565
AA Change: E348G

DomainStartEndE-ValueType
Pfam:Tweety 25 430 1.8e-182 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199157
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tweety family of proteins. Members of this family function as chloride anion channels. The encoded protein functions as a calcium(2+)-activated large conductance chloride(-) channel. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,194,444 L897P possibly damaging Het
Agbl2 A G 2: 90,797,547 E232G probably damaging Het
Atf7 A G 15: 102,534,235 S480P probably benign Het
Cdk14 A G 5: 5,195,325 I166T possibly damaging Het
Cdk5rap2 G T 4: 70,349,156 F358L probably benign Het
Cytip A G 2: 58,159,974 S28P probably benign Het
Dennd5b C T 6: 149,044,604 R503Q probably damaging Het
Dnajc10 T A 2: 80,340,815 C480S probably damaging Het
Drc7 A G 8: 95,059,083 D189G probably damaging Het
Engase G A 11: 118,481,295 V138M probably damaging Het
Esyt3 C A 9: 99,338,787 R121L probably damaging Het
Frem1 T G 4: 82,940,681 I1516L probably benign Het
Gatad2b T A 3: 90,351,417 I249N probably damaging Het
Grk6 T C 13: 55,454,406 S383P probably benign Het
Hectd1 C T 12: 51,827,351 probably null Het
Hipk2 A G 6: 38,818,644 L230P probably damaging Het
Hivep1 A T 13: 42,157,338 Q1018L probably benign Het
Itgad T C 7: 128,198,378 F927S probably benign Het
Itgb3bp A G 4: 99,814,098 V3A probably damaging Het
Kcnh7 G T 2: 62,787,687 A486D possibly damaging Het
Krt2 T C 15: 101,815,087 T318A probably benign Het
Ndrg1 A G 15: 66,946,528 F77S probably damaging Het
Nlrp4c T A 7: 6,065,709 L203* probably null Het
Nos1 T A 5: 117,947,431 C1275S probably damaging Het
Olfr1052 T A 2: 86,298,220 S135T probably benign Het
Olfr1167 T C 2: 88,149,372 T216A possibly damaging Het
Olfr1241 A G 2: 89,483,114 V7A possibly damaging Het
Olfr1431 T C 19: 12,209,878 I104T possibly damaging Het
Olfr294 T C 7: 86,615,692 S318G probably null Het
Olfr875 A T 9: 37,773,141 N161Y possibly damaging Het
Pip4k2b T C 11: 97,732,716 M67V possibly damaging Het
Polq C A 16: 37,089,353 Y2366* probably null Het
Prg3 T C 2: 84,988,753 S8P probably benign Het
Prl7c1 A T 13: 27,778,969 L17* probably null Het
Prl8a8 A T 13: 27,511,496 S51R probably damaging Het
Pttg1 G C 11: 43,421,149 P160A probably benign Het
Rbfox1 C A 16: 7,353,003 R276S possibly damaging Het
Rnase2a T G 14: 51,255,531 M126L probably benign Het
Secisbp2 A T 13: 51,656,907 K202* probably null Het
Sema6c A G 3: 95,168,845 H236R possibly damaging Het
Sept12 A G 16: 4,991,993 L181P probably damaging Het
Shc3 A T 13: 51,431,205 V458D possibly damaging Het
Tecta A G 9: 42,366,943 Y1090H probably benign Het
Thsd7a A T 6: 12,379,430 N998K Het
Tmem131l A T 3: 83,919,459 S1184T possibly damaging Het
Tnfsf15 T C 4: 63,729,650 D251G probably damaging Het
Unc5c T C 3: 141,733,904 L186P probably damaging Het
Vmn2r37 A T 7: 9,216,046 N446K probably damaging Het
Vmn2r63 T C 7: 42,928,535 D193G possibly damaging Het
Vmn2r85 A T 10: 130,426,507 M121K probably benign Het
Vmn2r88 A G 14: 51,413,796 D189G Het
Vwc2l C A 1: 70,729,093 C105* probably null Het
Wdr72 T A 9: 74,148,315 D275E probably damaging Het
Zfhx4 A T 3: 5,402,489 D2594V probably damaging Het
Zfp174 C T 16: 3,854,405 H273Y probably benign Het
Zwilch A G 9: 64,161,376 S203P probably damaging Het
Other mutations in Ttyh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Ttyh3 APN 5 140629412 missense probably damaging 0.99
IGL01324:Ttyh3 APN 5 140631513 missense probably benign 0.00
IGL01982:Ttyh3 APN 5 140636074 splice site probably benign
IGL02002:Ttyh3 APN 5 140629483 missense probably damaging 1.00
IGL02218:Ttyh3 APN 5 140626491 missense probably damaging 1.00
IGL02385:Ttyh3 APN 5 140633305 missense probably benign 0.03
IGL02510:Ttyh3 APN 5 140629464 missense probably damaging 1.00
R0843:Ttyh3 UTSW 5 140626446 splice site probably null
R3037:Ttyh3 UTSW 5 140648842 start gained probably benign
R3774:Ttyh3 UTSW 5 140648734 missense probably damaging 0.99
R4795:Ttyh3 UTSW 5 140634786 missense probably damaging 1.00
R4796:Ttyh3 UTSW 5 140634786 missense probably damaging 1.00
R4868:Ttyh3 UTSW 5 140629466 missense probably damaging 1.00
R5671:Ttyh3 UTSW 5 140631552 missense probably benign 0.02
R6107:Ttyh3 UTSW 5 140633562 critical splice donor site probably null
R6363:Ttyh3 UTSW 5 140635224 missense probably damaging 1.00
R7454:Ttyh3 UTSW 5 140629425 missense possibly damaging 0.95
R7798:Ttyh3 UTSW 5 140634783 missense probably damaging 1.00
R7810:Ttyh3 UTSW 5 140625141 missense
Predicted Primers PCR Primer
(F):5'- ACTTGCTAGACCACACTGGATG -3'
(R):5'- TGTTTCCAAGGCTCAGCACC -3'

Sequencing Primer
(F):5'- TGTCCCTTACATGAGGCGG -3'
(R):5'- CCAGACTTGCATTTCTGAAAGC -3'
Posted On2019-05-15