Incidental Mutation 'R7104:Thsd7a'
ID551049
Institutional Source Beutler Lab
Gene Symbol Thsd7a
Ensembl Gene ENSMUSG00000032625
Gene Namethrombospondin, type I, domain containing 7A
SynonymsLOC330267
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7104 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location12311610-12749410 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 12379430 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 998 (N998K)
Ref Sequence ENSEMBL: ENSMUSP00000113681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119581] [ENSMUST00000172356]
Predicted Effect
SMART Domains Protein: ENSMUSP00000113681
Gene: ENSMUSG00000032625
AA Change: N998K

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
TSP1 49 105 4.88e0 SMART
TSP1 186 236 1.58e-16 SMART
low complexity region 264 278 N/A INTRINSIC
low complexity region 290 304 N/A INTRINSIC
TSP1 352 408 9.98e-5 SMART
TSP1 415 499 3.14e0 SMART
TSP1 504 563 6.62e-1 SMART
TSP1 626 684 1.24e-9 SMART
TSP1 687 758 1.48e0 SMART
TSP1 763 820 6.24e-6 SMART
TSP1 898 948 7.31e-2 SMART
TSP1 1027 1082 9.09e-8 SMART
TSP1 1085 1150 5.82e-1 SMART
TSP1 1155 1207 4.24e-2 SMART
TSP1 1210 1271 1e0 SMART
TSP1 1276 1328 3.55e-10 SMART
TSP1 1329 1399 7.5e-2 SMART
TSP1 1404 1462 1.55e-1 SMART
transmembrane domain 1594 1616 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000172356
AA Change: N998K

PolyPhen 2 Score 0.558 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000131662
Gene: ENSMUSG00000032625
AA Change: N998K

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
TSP1 49 105 4.88e0 SMART
TSP1 186 236 1.58e-16 SMART
low complexity region 264 278 N/A INTRINSIC
low complexity region 290 304 N/A INTRINSIC
TSP1 352 408 9.98e-5 SMART
TSP1 415 499 3.14e0 SMART
TSP1 504 563 6.62e-1 SMART
TSP1 626 684 1.24e-9 SMART
TSP1 687 758 1.48e0 SMART
TSP1 763 820 6.24e-6 SMART
TSP1 898 948 7.31e-2 SMART
TSP1 1027 1084 1.95e-7 SMART
TSP1 1087 1152 5.82e-1 SMART
TSP1 1157 1209 4.24e-2 SMART
TSP1 1212 1273 1e0 SMART
TSP1 1278 1330 3.55e-10 SMART
TSP1 1331 1401 7.5e-2 SMART
TSP1 1406 1464 1.55e-1 SMART
transmembrane domain 1596 1618 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found almost exclusively in endothelial cells from placenta and umbilical cord. The encoded protein appears to interact with alpha(V)beta(3) integrin and paxillin to inhibit endothelial cell migration and tube formation. This protein may be involved in cytoskeletal organization. Variations in this gene may be associated with low bone mineral density in osteoporosis. [provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,194,444 L897P possibly damaging Het
Agbl2 A G 2: 90,797,547 E232G probably damaging Het
Atf7 A G 15: 102,534,235 S480P probably benign Het
Cdk14 A G 5: 5,195,325 I166T possibly damaging Het
Cdk5rap2 G T 4: 70,349,156 F358L probably benign Het
Cytip A G 2: 58,159,974 S28P probably benign Het
Dennd5b C T 6: 149,044,604 R503Q probably damaging Het
Dnajc10 T A 2: 80,340,815 C480S probably damaging Het
Drc7 A G 8: 95,059,083 D189G probably damaging Het
Engase G A 11: 118,481,295 V138M probably damaging Het
Esyt3 C A 9: 99,338,787 R121L probably damaging Het
Frem1 T G 4: 82,940,681 I1516L probably benign Het
Gatad2b T A 3: 90,351,417 I249N probably damaging Het
Grk6 T C 13: 55,454,406 S383P probably benign Het
Hectd1 C T 12: 51,827,351 probably null Het
Hipk2 A G 6: 38,818,644 L230P probably damaging Het
Hivep1 A T 13: 42,157,338 Q1018L probably benign Het
Itgad T C 7: 128,198,378 F927S probably benign Het
Itgb3bp A G 4: 99,814,098 V3A probably damaging Het
Kcnh7 G T 2: 62,787,687 A486D possibly damaging Het
Krt2 T C 15: 101,815,087 T318A probably benign Het
Ndrg1 A G 15: 66,946,528 F77S probably damaging Het
Nlrp4c T A 7: 6,065,709 L203* probably null Het
Nos1 T A 5: 117,947,431 C1275S probably damaging Het
Olfr1052 T A 2: 86,298,220 S135T probably benign Het
Olfr1167 T C 2: 88,149,372 T216A possibly damaging Het
Olfr1241 A G 2: 89,483,114 V7A possibly damaging Het
Olfr1431 T C 19: 12,209,878 I104T possibly damaging Het
Olfr294 T C 7: 86,615,692 S318G probably null Het
Olfr875 A T 9: 37,773,141 N161Y possibly damaging Het
Pip4k2b T C 11: 97,732,716 M67V possibly damaging Het
Polq C A 16: 37,089,353 Y2366* probably null Het
Prg3 T C 2: 84,988,753 S8P probably benign Het
Prl7c1 A T 13: 27,778,969 L17* probably null Het
Prl8a8 A T 13: 27,511,496 S51R probably damaging Het
Pttg1 G C 11: 43,421,149 P160A probably benign Het
Rbfox1 C A 16: 7,353,003 R276S possibly damaging Het
Rnase2a T G 14: 51,255,531 M126L probably benign Het
Secisbp2 A T 13: 51,656,907 K202* probably null Het
Sema6c A G 3: 95,168,845 H236R possibly damaging Het
Sept12 A G 16: 4,991,993 L181P probably damaging Het
Shc3 A T 13: 51,431,205 V458D possibly damaging Het
Tecta A G 9: 42,366,943 Y1090H probably benign Het
Tmem131l A T 3: 83,919,459 S1184T possibly damaging Het
Tnfsf15 T C 4: 63,729,650 D251G probably damaging Het
Ttyh3 T C 5: 140,629,785 E348G probably benign Het
Unc5c T C 3: 141,733,904 L186P probably damaging Het
Vmn2r37 A T 7: 9,216,046 N446K probably damaging Het
Vmn2r63 T C 7: 42,928,535 D193G possibly damaging Het
Vmn2r85 A T 10: 130,426,507 M121K probably benign Het
Vmn2r88 A G 14: 51,413,796 D189G Het
Vwc2l C A 1: 70,729,093 C105* probably null Het
Wdr72 T A 9: 74,148,315 D275E probably damaging Het
Zfhx4 A T 3: 5,402,489 D2594V probably damaging Het
Zfp174 C T 16: 3,854,405 H273Y probably benign Het
Zwilch A G 9: 64,161,376 S203P probably damaging Het
Other mutations in Thsd7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Thsd7a APN 6 12379659 splice site probably null
IGL00563:Thsd7a APN 6 12379659 splice site probably null
IGL00753:Thsd7a APN 6 12327529 missense probably damaging 1.00
IGL00835:Thsd7a APN 6 12554934 missense probably damaging 1.00
IGL01486:Thsd7a APN 6 12471080 missense probably damaging 1.00
IGL01730:Thsd7a APN 6 12554981 missense probably benign 0.05
IGL01931:Thsd7a APN 6 12504099 missense probably damaging 1.00
IGL01935:Thsd7a APN 6 12317419 missense probably damaging 1.00
IGL01978:Thsd7a APN 6 12331006 missense probably benign 0.01
IGL02233:Thsd7a APN 6 12555258 missense probably benign 0.00
IGL02354:Thsd7a APN 6 12348193 splice site probably benign
IGL02361:Thsd7a APN 6 12348193 splice site probably benign
IGL02375:Thsd7a APN 6 12343265 missense probably damaging 1.00
IGL02468:Thsd7a APN 6 12318171 missense probably damaging 0.98
IGL02616:Thsd7a APN 6 12408985 missense probably damaging 0.98
IGL02820:Thsd7a APN 6 12321072 missense probably damaging 1.00
IGL02858:Thsd7a APN 6 12500995 missense probably benign 0.16
IGL03074:Thsd7a APN 6 12324681 missense probably damaging 0.99
IGL03234:Thsd7a APN 6 12343178 missense probably damaging 1.00
IGL03244:Thsd7a APN 6 12504168 splice site probably benign
IGL03337:Thsd7a APN 6 12405174 missense probably damaging 1.00
PIT4354001:Thsd7a UTSW 6 12331927 critical splice donor site probably null
R0095:Thsd7a UTSW 6 12320970 missense probably damaging 0.99
R0127:Thsd7a UTSW 6 12554908 missense probably benign 0.01
R0142:Thsd7a UTSW 6 12418335 missense probably damaging 1.00
R0226:Thsd7a UTSW 6 12321900 missense possibly damaging 0.94
R0242:Thsd7a UTSW 6 12503916 missense probably benign 0.32
R0242:Thsd7a UTSW 6 12503916 missense probably benign 0.32
R0359:Thsd7a UTSW 6 12352031 missense probably damaging 1.00
R0365:Thsd7a UTSW 6 12321887 critical splice donor site probably null
R0504:Thsd7a UTSW 6 12379594 missense probably damaging 0.99
R0512:Thsd7a UTSW 6 12379605 missense possibly damaging 0.67
R0540:Thsd7a UTSW 6 12331542 splice site probably null
R0577:Thsd7a UTSW 6 12321048 missense possibly damaging 0.50
R0607:Thsd7a UTSW 6 12331542 splice site probably null
R0755:Thsd7a UTSW 6 12555369 missense probably damaging 1.00
R0771:Thsd7a UTSW 6 12327577 missense probably benign 0.09
R0780:Thsd7a UTSW 6 12337274 missense probably damaging 1.00
R0870:Thsd7a UTSW 6 12337274 missense probably damaging 1.00
R0871:Thsd7a UTSW 6 12337274 missense probably damaging 1.00
R0872:Thsd7a UTSW 6 12337274 missense probably damaging 1.00
R0873:Thsd7a UTSW 6 12337274 missense probably damaging 1.00
R1102:Thsd7a UTSW 6 12555702 missense possibly damaging 0.58
R1144:Thsd7a UTSW 6 12471027 splice site probably benign
R1265:Thsd7a UTSW 6 12317419 missense probably damaging 0.99
R1276:Thsd7a UTSW 6 12418370 missense probably damaging 1.00
R1381:Thsd7a UTSW 6 12555439 missense probably damaging 1.00
R1473:Thsd7a UTSW 6 12338622 missense probably benign 0.08
R1519:Thsd7a UTSW 6 12471175 missense probably benign 0.01
R1633:Thsd7a UTSW 6 12471104 nonsense probably null
R1659:Thsd7a UTSW 6 12504064 missense possibly damaging 0.73
R1769:Thsd7a UTSW 6 12555715 nonsense probably null
R1824:Thsd7a UTSW 6 12409042 splice site probably null
R1840:Thsd7a UTSW 6 12330974 missense probably benign 0.03
R1845:Thsd7a UTSW 6 12321041 missense probably damaging 1.00
R1874:Thsd7a UTSW 6 12555435 missense possibly damaging 0.76
R2023:Thsd7a UTSW 6 12327536 missense probably benign 0.16
R2039:Thsd7a UTSW 6 12408923 missense possibly damaging 0.77
R2058:Thsd7a UTSW 6 12318106 splice site probably benign
R2138:Thsd7a UTSW 6 12471073 nonsense probably null
R2155:Thsd7a UTSW 6 12379633 missense probably damaging 1.00
R2175:Thsd7a UTSW 6 12331944 missense possibly damaging 0.95
R2216:Thsd7a UTSW 6 12337268 missense possibly damaging 0.95
R2318:Thsd7a UTSW 6 12405147 missense probably damaging 1.00
R2375:Thsd7a UTSW 6 12337362 missense probably damaging 1.00
R3857:Thsd7a UTSW 6 12555226 missense probably benign 0.15
R3858:Thsd7a UTSW 6 12555226 missense probably benign 0.15
R3890:Thsd7a UTSW 6 12418337 missense probably benign 0.09
R3910:Thsd7a UTSW 6 12331549 missense probably damaging 0.96
R3933:Thsd7a UTSW 6 12555226 missense probably benign 0.15
R4369:Thsd7a UTSW 6 12468908 missense probably damaging 1.00
R4447:Thsd7a UTSW 6 12324635 missense probably damaging 0.98
R4664:Thsd7a UTSW 6 12337314 missense possibly damaging 0.79
R4664:Thsd7a UTSW 6 12504013 missense possibly damaging 0.90
R4665:Thsd7a UTSW 6 12337314 missense possibly damaging 0.79
R4665:Thsd7a UTSW 6 12504013 missense possibly damaging 0.90
R4666:Thsd7a UTSW 6 12337314 missense possibly damaging 0.79
R4666:Thsd7a UTSW 6 12504013 missense possibly damaging 0.90
R4668:Thsd7a UTSW 6 12408968 missense probably damaging 0.98
R4886:Thsd7a UTSW 6 12327660 nonsense probably null
R4918:Thsd7a UTSW 6 12327559 missense probably damaging 1.00
R4938:Thsd7a UTSW 6 12330992 missense probably benign 0.09
R5064:Thsd7a UTSW 6 12330952 missense possibly damaging 0.66
R5153:Thsd7a UTSW 6 12338655 missense probably benign 0.00
R5177:Thsd7a UTSW 6 12379583 nonsense probably null
R5242:Thsd7a UTSW 6 12327583 missense probably damaging 1.00
R5267:Thsd7a UTSW 6 12379602 missense probably damaging 1.00
R5442:Thsd7a UTSW 6 12748800 missense probably benign 0.00
R5506:Thsd7a UTSW 6 12332017 missense possibly damaging 0.85
R5525:Thsd7a UTSW 6 12332007 missense possibly damaging 0.52
R5544:Thsd7a UTSW 6 12379471 missense possibly damaging 0.94
R5651:Thsd7a UTSW 6 12343213 missense probably damaging 1.00
R5716:Thsd7a UTSW 6 12343148 missense probably benign 0.00
R5848:Thsd7a UTSW 6 12503923 missense probably damaging 1.00
R5958:Thsd7a UTSW 6 12337262 missense probably benign 0.02
R6012:Thsd7a UTSW 6 12379389 splice site probably null
R6139:Thsd7a UTSW 6 12379573 missense possibly damaging 0.93
R6243:Thsd7a UTSW 6 12327602 missense probably damaging 1.00
R6257:Thsd7a UTSW 6 12408988 nonsense probably null
R6273:Thsd7a UTSW 6 12408836 missense probably damaging 0.99
R6300:Thsd7a UTSW 6 12471104 nonsense probably null
R6314:Thsd7a UTSW 6 12554997 missense possibly damaging 0.87
R6392:Thsd7a UTSW 6 12468929 missense probably damaging 0.99
R6418:Thsd7a UTSW 6 12555082 nonsense probably null
R6515:Thsd7a UTSW 6 12501086 missense possibly damaging 0.47
R6725:Thsd7a UTSW 6 12555631 missense possibly damaging 0.87
R6742:Thsd7a UTSW 6 12408816 missense probably damaging 1.00
R6776:Thsd7a UTSW 6 12555637 missense possibly damaging 0.53
R6838:Thsd7a UTSW 6 12504075 missense probably damaging 0.99
R7170:Thsd7a UTSW 6 12352091 missense
R7349:Thsd7a UTSW 6 12352068 missense
R7460:Thsd7a UTSW 6 12554934 missense
R7467:Thsd7a UTSW 6 12331585 missense
R7666:Thsd7a UTSW 6 12379438 missense
Predicted Primers PCR Primer
(F):5'- AACCATCTGATAATGCTCGAGTC -3'
(R):5'- TTGTACCCTCTGATCGAGACC -3'

Sequencing Primer
(F):5'- AATGCTCGAGTCTTAAGTCCTG -3'
(R):5'- GATCGAGACCCAGTATTGTCC -3'
Posted On2019-05-15