Incidental Mutation 'R7104:Hipk2'
ID 551050
Institutional Source Beutler Lab
Gene Symbol Hipk2
Ensembl Gene ENSMUSG00000061436
Gene Name homeodomain interacting protein kinase 2
Synonyms B230339E18Rik, 1110014O20Rik, Stank
MMRRC Submission 045196-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.958) question?
Stock # R7104 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 38671325-38853099 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 38795579 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 230 (L230P)
Ref Sequence ENSEMBL: ENSMUSP00000124133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160360] [ENSMUST00000160962] [ENSMUST00000161779] [ENSMUST00000162359]
AlphaFold Q9QZR5
Predicted Effect probably damaging
Transcript: ENSMUST00000160360
AA Change: L230P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000125500
Gene: ENSMUSG00000061436
AA Change: L230P

DomainStartEndE-ValueType
low complexity region 94 104 N/A INTRINSIC
low complexity region 156 180 N/A INTRINSIC
S_TKc 199 527 3.05e-78 SMART
low complexity region 895 909 N/A INTRINSIC
low complexity region 963 992 N/A INTRINSIC
low complexity region 998 1018 N/A INTRINSIC
low complexity region 1057 1072 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160962
AA Change: L223P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000125572
Gene: ENSMUSG00000061436
AA Change: L223P

DomainStartEndE-ValueType
low complexity region 87 97 N/A INTRINSIC
low complexity region 149 173 N/A INTRINSIC
S_TKc 192 520 3.05e-78 SMART
low complexity region 888 902 N/A INTRINSIC
low complexity region 956 985 N/A INTRINSIC
low complexity region 991 1011 N/A INTRINSIC
low complexity region 1050 1065 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161779
AA Change: L230P

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124133
Gene: ENSMUSG00000061436
AA Change: L230P

DomainStartEndE-ValueType
low complexity region 94 104 N/A INTRINSIC
low complexity region 156 180 N/A INTRINSIC
S_TKc 199 527 3.05e-78 SMART
low complexity region 923 937 N/A INTRINSIC
low complexity region 991 1020 N/A INTRINSIC
low complexity region 1026 1046 N/A INTRINSIC
low complexity region 1085 1100 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162359
AA Change: L230P

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125150
Gene: ENSMUSG00000061436
AA Change: L230P

DomainStartEndE-ValueType
low complexity region 94 104 N/A INTRINSIC
low complexity region 156 180 N/A INTRINSIC
S_TKc 199 527 3.05e-78 SMART
low complexity region 896 910 N/A INTRINSIC
low complexity region 964 993 N/A INTRINSIC
low complexity region 999 1019 N/A INTRINSIC
low complexity region 1058 1073 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved serine/threonine kinase that is a member of the homeodomain-interacting protein kinase family. The encoded protein interacts with homeodomain transcription factors and many other transcription factors such as p53, and can function as both a corepressor and a coactivator depending on the transcription factor and its subcellular localization. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous null mice display decreased apoptosis and increased neuron numbers in the trigeminal ganglion. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted(7) Gene trapped(3)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl2 A G 2: 90,627,891 (GRCm39) E232G probably damaging Het
Atf7 A G 15: 102,442,670 (GRCm39) S480P probably benign Het
Cdk14 A G 5: 5,245,325 (GRCm39) I166T possibly damaging Het
Cdk5rap2 G T 4: 70,267,393 (GRCm39) F358L probably benign Het
Cplane1 T C 15: 8,223,928 (GRCm39) L897P possibly damaging Het
Cytip A G 2: 58,049,986 (GRCm39) S28P probably benign Het
Dennd5b C T 6: 148,946,102 (GRCm39) R503Q probably damaging Het
Dnajc10 T A 2: 80,171,159 (GRCm39) C480S probably damaging Het
Drc7 A G 8: 95,785,711 (GRCm39) D189G probably damaging Het
Engase G A 11: 118,372,121 (GRCm39) V138M probably damaging Het
Esyt3 C A 9: 99,220,840 (GRCm39) R121L probably damaging Het
Frem1 T G 4: 82,858,918 (GRCm39) I1516L probably benign Het
Gatad2b T A 3: 90,258,724 (GRCm39) I249N probably damaging Het
Grk6 T C 13: 55,602,219 (GRCm39) S383P probably benign Het
Hectd1 C T 12: 51,874,134 (GRCm39) probably null Het
Hivep1 A T 13: 42,310,814 (GRCm39) Q1018L probably benign Het
Itgad T C 7: 127,797,550 (GRCm39) F927S probably benign Het
Itgb3bp A G 4: 99,702,335 (GRCm39) V3A probably damaging Het
Kcnh7 G T 2: 62,618,031 (GRCm39) A486D possibly damaging Het
Krt1c T C 15: 101,723,522 (GRCm39) T318A probably benign Het
Ndrg1 A G 15: 66,818,377 (GRCm39) F77S probably damaging Het
Nlrp4c T A 7: 6,068,708 (GRCm39) L203* probably null Het
Nos1 T A 5: 118,085,496 (GRCm39) C1275S probably damaging Het
Or14a256 T C 7: 86,264,900 (GRCm39) S318G probably null Het
Or4a69 A G 2: 89,313,458 (GRCm39) V7A possibly damaging Het
Or5an9 T C 19: 12,187,242 (GRCm39) I104T possibly damaging Het
Or5d39 T C 2: 87,979,716 (GRCm39) T216A possibly damaging Het
Or5j3 T A 2: 86,128,564 (GRCm39) S135T probably benign Het
Or8b12b A T 9: 37,684,437 (GRCm39) N161Y possibly damaging Het
Pip4k2b T C 11: 97,623,542 (GRCm39) M67V possibly damaging Het
Polq C A 16: 36,909,715 (GRCm39) Y2366* probably null Het
Prg3 T C 2: 84,819,097 (GRCm39) S8P probably benign Het
Prl7c1 A T 13: 27,962,952 (GRCm39) L17* probably null Het
Prl8a8 A T 13: 27,695,479 (GRCm39) S51R probably damaging Het
Pttg1 G C 11: 43,311,976 (GRCm39) P160A probably benign Het
Rbfox1 C A 16: 7,170,867 (GRCm39) R276S possibly damaging Het
Rnase2a T G 14: 51,492,988 (GRCm39) M126L probably benign Het
Secisbp2 A T 13: 51,810,943 (GRCm39) K202* probably null Het
Sema6c A G 3: 95,076,156 (GRCm39) H236R possibly damaging Het
Septin12 A G 16: 4,809,857 (GRCm39) L181P probably damaging Het
Shc3 A T 13: 51,585,241 (GRCm39) V458D possibly damaging Het
Tecta A G 9: 42,278,239 (GRCm39) Y1090H probably benign Het
Thsd7a A T 6: 12,379,429 (GRCm39) N998K Het
Tmem131l A T 3: 83,826,766 (GRCm39) S1184T possibly damaging Het
Tnfsf15 T C 4: 63,647,887 (GRCm39) D251G probably damaging Het
Ttyh3 T C 5: 140,615,540 (GRCm39) E348G probably benign Het
Unc5c T C 3: 141,439,665 (GRCm39) L186P probably damaging Het
Vmn2r37 A T 7: 9,219,045 (GRCm39) N446K probably damaging Het
Vmn2r63 T C 7: 42,577,959 (GRCm39) D193G possibly damaging Het
Vmn2r85 A T 10: 130,262,376 (GRCm39) M121K probably benign Het
Vmn2r88 A G 14: 51,651,253 (GRCm39) D189G Het
Vwc2l C A 1: 70,768,252 (GRCm39) C105* probably null Het
Wdr72 T A 9: 74,055,597 (GRCm39) D275E probably damaging Het
Zfhx4 A T 3: 5,467,549 (GRCm39) D2594V probably damaging Het
Zfp174 C T 16: 3,672,269 (GRCm39) H273Y probably benign Het
Zwilch A G 9: 64,068,658 (GRCm39) S203P probably damaging Het
Other mutations in Hipk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Hipk2 APN 6 38,796,257 (GRCm39) splice site probably benign
IGL00814:Hipk2 APN 6 38,795,484 (GRCm39) missense probably damaging 1.00
IGL00907:Hipk2 APN 6 38,795,208 (GRCm39) missense probably damaging 1.00
IGL01350:Hipk2 APN 6 38,795,250 (GRCm39) missense probably damaging 1.00
IGL01714:Hipk2 APN 6 38,796,117 (GRCm39) missense probably damaging 1.00
IGL01893:Hipk2 APN 6 38,795,330 (GRCm39) missense probably benign 0.05
IGL02028:Hipk2 APN 6 38,795,691 (GRCm39) missense possibly damaging 0.67
IGL02133:Hipk2 APN 6 38,796,069 (GRCm39) missense probably benign
IGL02135:Hipk2 APN 6 38,795,934 (GRCm39) missense possibly damaging 0.90
IGL02543:Hipk2 APN 6 38,680,436 (GRCm39) missense possibly damaging 0.95
IGL02630:Hipk2 APN 6 38,795,456 (GRCm39) missense possibly damaging 0.48
IGL02896:Hipk2 APN 6 38,675,382 (GRCm39) missense probably damaging 1.00
IGL02900:Hipk2 APN 6 38,706,879 (GRCm39) missense probably damaging 0.96
IGL03345:Hipk2 APN 6 38,724,937 (GRCm39) splice site probably benign
R0070:Hipk2 UTSW 6 38,795,919 (GRCm39) nonsense probably null
R0070:Hipk2 UTSW 6 38,795,919 (GRCm39) nonsense probably null
R0092:Hipk2 UTSW 6 38,720,164 (GRCm39) missense probably damaging 0.97
R0184:Hipk2 UTSW 6 38,695,866 (GRCm39) missense possibly damaging 0.77
R0494:Hipk2 UTSW 6 38,706,924 (GRCm39) missense probably benign 0.03
R0617:Hipk2 UTSW 6 38,724,420 (GRCm39) missense possibly damaging 0.70
R0720:Hipk2 UTSW 6 38,675,491 (GRCm39) missense probably damaging 1.00
R1812:Hipk2 UTSW 6 38,675,098 (GRCm39) missense probably benign 0.14
R1864:Hipk2 UTSW 6 38,695,870 (GRCm39) critical splice acceptor site probably null
R1919:Hipk2 UTSW 6 38,795,919 (GRCm39) nonsense probably null
R1995:Hipk2 UTSW 6 38,692,909 (GRCm39) missense probably damaging 1.00
R2079:Hipk2 UTSW 6 38,795,720 (GRCm39) missense probably damaging 1.00
R2238:Hipk2 UTSW 6 38,706,850 (GRCm39) splice site probably benign
R2384:Hipk2 UTSW 6 38,795,306 (GRCm39) missense probably damaging 0.99
R3775:Hipk2 UTSW 6 38,720,029 (GRCm39) missense probably damaging 0.99
R3792:Hipk2 UTSW 6 38,675,491 (GRCm39) missense probably damaging 1.00
R3841:Hipk2 UTSW 6 38,795,861 (GRCm39) missense probably damaging 1.00
R3883:Hipk2 UTSW 6 38,676,200 (GRCm39) missense probably damaging 1.00
R4471:Hipk2 UTSW 6 38,713,857 (GRCm39) intron probably benign
R4724:Hipk2 UTSW 6 38,675,327 (GRCm39) missense probably benign 0.10
R4838:Hipk2 UTSW 6 38,795,339 (GRCm39) missense possibly damaging 0.94
R4843:Hipk2 UTSW 6 38,796,192 (GRCm39) missense possibly damaging 0.94
R5040:Hipk2 UTSW 6 38,707,816 (GRCm39) missense possibly damaging 0.82
R5044:Hipk2 UTSW 6 38,795,814 (GRCm39) missense probably benign 0.06
R5320:Hipk2 UTSW 6 38,795,212 (GRCm39) missense probably damaging 1.00
R5409:Hipk2 UTSW 6 38,706,977 (GRCm39) missense probably damaging 1.00
R5682:Hipk2 UTSW 6 38,714,408 (GRCm39) missense possibly damaging 0.50
R5695:Hipk2 UTSW 6 38,795,810 (GRCm39) missense possibly damaging 0.64
R5876:Hipk2 UTSW 6 38,707,802 (GRCm39) critical splice donor site probably null
R6309:Hipk2 UTSW 6 38,675,446 (GRCm39) missense probably damaging 1.00
R6612:Hipk2 UTSW 6 38,795,808 (GRCm39) missense probably benign 0.04
R6815:Hipk2 UTSW 6 38,795,777 (GRCm39) missense probably damaging 1.00
R7124:Hipk2 UTSW 6 38,795,413 (GRCm39) nonsense probably null
R7238:Hipk2 UTSW 6 38,692,992 (GRCm39) missense probably benign 0.45
R7712:Hipk2 UTSW 6 38,680,569 (GRCm39) missense probably benign 0.02
R7994:Hipk2 UTSW 6 38,795,403 (GRCm39) missense possibly damaging 0.94
R8190:Hipk2 UTSW 6 38,795,728 (GRCm39) missense possibly damaging 0.88
R8388:Hipk2 UTSW 6 38,722,630 (GRCm39) missense probably damaging 1.00
R8796:Hipk2 UTSW 6 38,675,158 (GRCm39) missense probably damaging 0.99
R9041:Hipk2 UTSW 6 38,724,909 (GRCm39) nonsense probably null
R9388:Hipk2 UTSW 6 38,707,956 (GRCm39) missense probably damaging 1.00
R9480:Hipk2 UTSW 6 38,680,377 (GRCm39) missense probably benign 0.37
R9485:Hipk2 UTSW 6 38,680,445 (GRCm39) missense possibly damaging 0.94
R9562:Hipk2 UTSW 6 38,724,390 (GRCm39) missense probably damaging 0.99
R9565:Hipk2 UTSW 6 38,724,390 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCATCAGGGCTGTGGCTAC -3'
(R):5'- AAAACAGTGGCTCCAACAGTG -3'

Sequencing Primer
(F):5'- GCAAGGGACTAAACTTGTTCTG -3'
(R):5'- CTCCAACAGTGAAGGGGACTATC -3'
Posted On 2019-05-15