Incidental Mutation 'R7104:Nlrp4c'
ID 551052
Institutional Source Beutler Lab
Gene Symbol Nlrp4c
Ensembl Gene ENSMUSG00000034690
Gene Name NLR family, pyrin domain containing 4C
Synonyms Nalp4c, Nalp-alpha, Rnh2
MMRRC Submission 045196-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.073) question?
Stock # R7104 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 6048160-6108148 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 6068708 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 203 (L203*)
Ref Sequence ENSEMBL: ENSMUSP00000046503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037728] [ENSMUST00000121583] [ENSMUST00000208360]
AlphaFold Q3TKR3
Predicted Effect probably null
Transcript: ENSMUST00000037728
AA Change: L203*
SMART Domains Protein: ENSMUSP00000046503
Gene: ENSMUSG00000034690
AA Change: L203*

DomainStartEndE-ValueType
PYRIN 6 89 1.41e-34 SMART
Pfam:NACHT 148 317 4.5e-40 PFAM
LRR 689 716 2.91e0 SMART
LRR 718 745 1.49e1 SMART
LRR 746 772 2.5e1 SMART
LRR 774 801 6.24e1 SMART
LRR 802 829 3.07e-1 SMART
LRR 831 858 4.11e-1 SMART
LRR 859 886 3.31e-6 SMART
LRR 888 915 6.16e0 SMART
LRR 916 943 9.24e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000121583
AA Change: L203*
SMART Domains Protein: ENSMUSP00000113824
Gene: ENSMUSG00000034690
AA Change: L203*

DomainStartEndE-ValueType
PYRIN 6 89 1.41e-34 SMART
Pfam:NACHT 148 317 1.7e-39 PFAM
LRR 689 716 2.91e0 SMART
LRR 718 745 1.49e1 SMART
LRR 746 772 2.5e1 SMART
LRR 774 801 6.24e1 SMART
LRR 802 829 3.07e-1 SMART
LRR 831 858 4.11e-1 SMART
LRR 859 886 3.31e-6 SMART
LRR 888 915 6.16e0 SMART
LRR 916 943 9.24e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000208360
AA Change: L203*
Meta Mutation Damage Score 0.9702 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl2 A G 2: 90,627,891 (GRCm39) E232G probably damaging Het
Atf7 A G 15: 102,442,670 (GRCm39) S480P probably benign Het
Cdk14 A G 5: 5,245,325 (GRCm39) I166T possibly damaging Het
Cdk5rap2 G T 4: 70,267,393 (GRCm39) F358L probably benign Het
Cplane1 T C 15: 8,223,928 (GRCm39) L897P possibly damaging Het
Cytip A G 2: 58,049,986 (GRCm39) S28P probably benign Het
Dennd5b C T 6: 148,946,102 (GRCm39) R503Q probably damaging Het
Dnajc10 T A 2: 80,171,159 (GRCm39) C480S probably damaging Het
Drc7 A G 8: 95,785,711 (GRCm39) D189G probably damaging Het
Engase G A 11: 118,372,121 (GRCm39) V138M probably damaging Het
Esyt3 C A 9: 99,220,840 (GRCm39) R121L probably damaging Het
Frem1 T G 4: 82,858,918 (GRCm39) I1516L probably benign Het
Gatad2b T A 3: 90,258,724 (GRCm39) I249N probably damaging Het
Grk6 T C 13: 55,602,219 (GRCm39) S383P probably benign Het
Hectd1 C T 12: 51,874,134 (GRCm39) probably null Het
Hipk2 A G 6: 38,795,579 (GRCm39) L230P probably damaging Het
Hivep1 A T 13: 42,310,814 (GRCm39) Q1018L probably benign Het
Itgad T C 7: 127,797,550 (GRCm39) F927S probably benign Het
Itgb3bp A G 4: 99,702,335 (GRCm39) V3A probably damaging Het
Kcnh7 G T 2: 62,618,031 (GRCm39) A486D possibly damaging Het
Krt1c T C 15: 101,723,522 (GRCm39) T318A probably benign Het
Ndrg1 A G 15: 66,818,377 (GRCm39) F77S probably damaging Het
Nos1 T A 5: 118,085,496 (GRCm39) C1275S probably damaging Het
Or14a256 T C 7: 86,264,900 (GRCm39) S318G probably null Het
Or4a69 A G 2: 89,313,458 (GRCm39) V7A possibly damaging Het
Or5an9 T C 19: 12,187,242 (GRCm39) I104T possibly damaging Het
Or5d39 T C 2: 87,979,716 (GRCm39) T216A possibly damaging Het
Or5j3 T A 2: 86,128,564 (GRCm39) S135T probably benign Het
Or8b12b A T 9: 37,684,437 (GRCm39) N161Y possibly damaging Het
Pip4k2b T C 11: 97,623,542 (GRCm39) M67V possibly damaging Het
Polq C A 16: 36,909,715 (GRCm39) Y2366* probably null Het
Prg3 T C 2: 84,819,097 (GRCm39) S8P probably benign Het
Prl7c1 A T 13: 27,962,952 (GRCm39) L17* probably null Het
Prl8a8 A T 13: 27,695,479 (GRCm39) S51R probably damaging Het
Pttg1 G C 11: 43,311,976 (GRCm39) P160A probably benign Het
Rbfox1 C A 16: 7,170,867 (GRCm39) R276S possibly damaging Het
Rnase2a T G 14: 51,492,988 (GRCm39) M126L probably benign Het
Secisbp2 A T 13: 51,810,943 (GRCm39) K202* probably null Het
Sema6c A G 3: 95,076,156 (GRCm39) H236R possibly damaging Het
Septin12 A G 16: 4,809,857 (GRCm39) L181P probably damaging Het
Shc3 A T 13: 51,585,241 (GRCm39) V458D possibly damaging Het
Tecta A G 9: 42,278,239 (GRCm39) Y1090H probably benign Het
Thsd7a A T 6: 12,379,429 (GRCm39) N998K Het
Tmem131l A T 3: 83,826,766 (GRCm39) S1184T possibly damaging Het
Tnfsf15 T C 4: 63,647,887 (GRCm39) D251G probably damaging Het
Ttyh3 T C 5: 140,615,540 (GRCm39) E348G probably benign Het
Unc5c T C 3: 141,439,665 (GRCm39) L186P probably damaging Het
Vmn2r37 A T 7: 9,219,045 (GRCm39) N446K probably damaging Het
Vmn2r63 T C 7: 42,577,959 (GRCm39) D193G possibly damaging Het
Vmn2r85 A T 10: 130,262,376 (GRCm39) M121K probably benign Het
Vmn2r88 A G 14: 51,651,253 (GRCm39) D189G Het
Vwc2l C A 1: 70,768,252 (GRCm39) C105* probably null Het
Wdr72 T A 9: 74,055,597 (GRCm39) D275E probably damaging Het
Zfhx4 A T 3: 5,467,549 (GRCm39) D2594V probably damaging Het
Zfp174 C T 16: 3,672,269 (GRCm39) H273Y probably benign Het
Zwilch A G 9: 64,068,658 (GRCm39) S203P probably damaging Het
Other mutations in Nlrp4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00727:Nlrp4c APN 7 6,069,701 (GRCm39) missense possibly damaging 0.80
IGL01458:Nlrp4c APN 7 6,103,783 (GRCm39) missense possibly damaging 0.94
IGL01464:Nlrp4c APN 7 6,103,783 (GRCm39) missense possibly damaging 0.94
IGL01470:Nlrp4c APN 7 6,103,783 (GRCm39) missense possibly damaging 0.94
IGL01481:Nlrp4c APN 7 6,103,783 (GRCm39) missense possibly damaging 0.94
IGL01531:Nlrp4c APN 7 6,063,655 (GRCm39) missense probably damaging 1.00
IGL01595:Nlrp4c APN 7 6,069,111 (GRCm39) nonsense probably null
IGL02087:Nlrp4c APN 7 6,095,582 (GRCm39) missense probably damaging 1.00
IGL02226:Nlrp4c APN 7 6,069,828 (GRCm39) missense possibly damaging 0.78
IGL02588:Nlrp4c APN 7 6,087,647 (GRCm39) missense probably benign 0.25
IGL02822:Nlrp4c APN 7 6,068,726 (GRCm39) missense probably damaging 1.00
IGL02884:Nlrp4c APN 7 6,101,951 (GRCm39) missense probably damaging 1.00
IGL02943:Nlrp4c APN 7 6,068,974 (GRCm39) missense probably damaging 0.96
IGL03017:Nlrp4c APN 7 6,087,679 (GRCm39) missense probably benign 0.23
R0347:Nlrp4c UTSW 7 6,069,415 (GRCm39) missense possibly damaging 0.69
R0579:Nlrp4c UTSW 7 6,063,844 (GRCm39) missense probably benign 0.05
R1051:Nlrp4c UTSW 7 6,068,942 (GRCm39) missense probably benign 0.01
R1596:Nlrp4c UTSW 7 6,069,777 (GRCm39) missense probably benign
R1636:Nlrp4c UTSW 7 6,069,737 (GRCm39) missense possibly damaging 0.64
R1739:Nlrp4c UTSW 7 6,076,221 (GRCm39) missense probably damaging 1.00
R1766:Nlrp4c UTSW 7 6,076,113 (GRCm39) missense probably benign 0.00
R1824:Nlrp4c UTSW 7 6,069,955 (GRCm39) splice site probably null
R1827:Nlrp4c UTSW 7 6,068,765 (GRCm39) missense probably damaging 1.00
R1858:Nlrp4c UTSW 7 6,087,655 (GRCm39) missense probably benign 0.02
R1902:Nlrp4c UTSW 7 6,068,818 (GRCm39) missense probably damaging 0.98
R2217:Nlrp4c UTSW 7 6,076,113 (GRCm39) missense probably benign
R2415:Nlrp4c UTSW 7 6,069,047 (GRCm39) missense probably damaging 1.00
R3004:Nlrp4c UTSW 7 6,068,524 (GRCm39) missense probably benign 0.28
R3005:Nlrp4c UTSW 7 6,068,524 (GRCm39) missense probably benign 0.28
R3410:Nlrp4c UTSW 7 6,095,569 (GRCm39) missense possibly damaging 0.69
R3411:Nlrp4c UTSW 7 6,095,569 (GRCm39) missense possibly damaging 0.69
R3710:Nlrp4c UTSW 7 6,068,627 (GRCm39) missense probably damaging 0.99
R4072:Nlrp4c UTSW 7 6,075,709 (GRCm39) missense probably benign 0.00
R4073:Nlrp4c UTSW 7 6,075,709 (GRCm39) missense probably benign 0.00
R4075:Nlrp4c UTSW 7 6,075,709 (GRCm39) missense probably benign 0.00
R4076:Nlrp4c UTSW 7 6,075,709 (GRCm39) missense probably benign 0.00
R4542:Nlrp4c UTSW 7 6,103,826 (GRCm39) nonsense probably null
R4709:Nlrp4c UTSW 7 6,068,424 (GRCm39) missense probably benign 0.31
R4776:Nlrp4c UTSW 7 6,069,125 (GRCm39) missense probably benign 0.41
R5043:Nlrp4c UTSW 7 6,069,824 (GRCm39) missense probably benign 0.01
R5258:Nlrp4c UTSW 7 6,069,622 (GRCm39) missense probably benign 0.06
R6164:Nlrp4c UTSW 7 6,095,507 (GRCm39) missense probably damaging 1.00
R6383:Nlrp4c UTSW 7 6,069,052 (GRCm39) missense probably benign
R6650:Nlrp4c UTSW 7 6,068,948 (GRCm39) missense probably damaging 0.99
R6810:Nlrp4c UTSW 7 6,069,754 (GRCm39) missense probably damaging 1.00
R7095:Nlrp4c UTSW 7 6,063,792 (GRCm39) missense probably damaging 0.97
R7102:Nlrp4c UTSW 7 6,068,708 (GRCm39) nonsense probably null
R7232:Nlrp4c UTSW 7 6,068,708 (GRCm39) nonsense probably null
R7444:Nlrp4c UTSW 7 6,095,595 (GRCm39) nonsense probably null
R7705:Nlrp4c UTSW 7 6,075,635 (GRCm39) missense probably damaging 0.97
R7966:Nlrp4c UTSW 7 6,069,322 (GRCm39) missense probably damaging 0.99
R8506:Nlrp4c UTSW 7 6,103,775 (GRCm39) missense possibly damaging 0.47
R8677:Nlrp4c UTSW 7 6,075,644 (GRCm39) missense probably damaging 0.99
R8708:Nlrp4c UTSW 7 6,068,603 (GRCm39) missense probably damaging 1.00
R8838:Nlrp4c UTSW 7 6,069,337 (GRCm39) missense
R9031:Nlrp4c UTSW 7 6,107,608 (GRCm39) makesense probably null
R9193:Nlrp4c UTSW 7 6,095,621 (GRCm39) missense probably benign
R9329:Nlrp4c UTSW 7 6,068,498 (GRCm39) missense probably benign
R9388:Nlrp4c UTSW 7 6,069,874 (GRCm39) nonsense probably null
R9474:Nlrp4c UTSW 7 6,068,626 (GRCm39) missense possibly damaging 0.83
R9567:Nlrp4c UTSW 7 6,063,624 (GRCm39) missense probably benign 0.17
R9702:Nlrp4c UTSW 7 6,068,801 (GRCm39) missense probably benign 0.00
X0060:Nlrp4c UTSW 7 6,068,917 (GRCm39) missense probably damaging 1.00
Z1088:Nlrp4c UTSW 7 6,069,635 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACATGGTGTTCCTGCAAGG -3'
(R):5'- CAAAAGTCTCTGGGGTAGCAG -3'

Sequencing Primer
(F):5'- GAGCAGCGGGAATTGGC -3'
(R):5'- AAGAGGATTTGGGGAGCATCTTCC -3'
Posted On 2019-05-15