Incidental Mutation 'R7104:Nlrp4c'
ID551052
Institutional Source Beutler Lab
Gene Symbol Nlrp4c
Ensembl Gene ENSMUSG00000034690
Gene NameNLR family, pyrin domain containing 4C
SynonymsNalp-alpha, Rnh2, Nalp4c
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R7104 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location6045161-6105150 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 6065709 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 203 (L203*)
Ref Sequence ENSEMBL: ENSMUSP00000046503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037728] [ENSMUST00000121583] [ENSMUST00000208360]
Predicted Effect probably null
Transcript: ENSMUST00000037728
AA Change: L203*
SMART Domains Protein: ENSMUSP00000046503
Gene: ENSMUSG00000034690
AA Change: L203*

DomainStartEndE-ValueType
PYRIN 6 89 1.41e-34 SMART
Pfam:NACHT 148 317 4.5e-40 PFAM
LRR 689 716 2.91e0 SMART
LRR 718 745 1.49e1 SMART
LRR 746 772 2.5e1 SMART
LRR 774 801 6.24e1 SMART
LRR 802 829 3.07e-1 SMART
LRR 831 858 4.11e-1 SMART
LRR 859 886 3.31e-6 SMART
LRR 888 915 6.16e0 SMART
LRR 916 943 9.24e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000121583
AA Change: L203*
SMART Domains Protein: ENSMUSP00000113824
Gene: ENSMUSG00000034690
AA Change: L203*

DomainStartEndE-ValueType
PYRIN 6 89 1.41e-34 SMART
Pfam:NACHT 148 317 1.7e-39 PFAM
LRR 689 716 2.91e0 SMART
LRR 718 745 1.49e1 SMART
LRR 746 772 2.5e1 SMART
LRR 774 801 6.24e1 SMART
LRR 802 829 3.07e-1 SMART
LRR 831 858 4.11e-1 SMART
LRR 859 886 3.31e-6 SMART
LRR 888 915 6.16e0 SMART
LRR 916 943 9.24e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000208360
AA Change: L203*
Meta Mutation Damage Score 0.9702 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,194,444 L897P possibly damaging Het
Agbl2 A G 2: 90,797,547 E232G probably damaging Het
Atf7 A G 15: 102,534,235 S480P probably benign Het
Cdk14 A G 5: 5,195,325 I166T possibly damaging Het
Cdk5rap2 G T 4: 70,349,156 F358L probably benign Het
Cytip A G 2: 58,159,974 S28P probably benign Het
Dennd5b C T 6: 149,044,604 R503Q probably damaging Het
Dnajc10 T A 2: 80,340,815 C480S probably damaging Het
Drc7 A G 8: 95,059,083 D189G probably damaging Het
Engase G A 11: 118,481,295 V138M probably damaging Het
Esyt3 C A 9: 99,338,787 R121L probably damaging Het
Frem1 T G 4: 82,940,681 I1516L probably benign Het
Gatad2b T A 3: 90,351,417 I249N probably damaging Het
Grk6 T C 13: 55,454,406 S383P probably benign Het
Hectd1 C T 12: 51,827,351 probably null Het
Hipk2 A G 6: 38,818,644 L230P probably damaging Het
Hivep1 A T 13: 42,157,338 Q1018L probably benign Het
Itgad T C 7: 128,198,378 F927S probably benign Het
Itgb3bp A G 4: 99,814,098 V3A probably damaging Het
Kcnh7 G T 2: 62,787,687 A486D possibly damaging Het
Krt2 T C 15: 101,815,087 T318A probably benign Het
Ndrg1 A G 15: 66,946,528 F77S probably damaging Het
Nos1 T A 5: 117,947,431 C1275S probably damaging Het
Olfr1052 T A 2: 86,298,220 S135T probably benign Het
Olfr1167 T C 2: 88,149,372 T216A possibly damaging Het
Olfr1241 A G 2: 89,483,114 V7A possibly damaging Het
Olfr1431 T C 19: 12,209,878 I104T possibly damaging Het
Olfr294 T C 7: 86,615,692 S318G probably null Het
Olfr875 A T 9: 37,773,141 N161Y possibly damaging Het
Pip4k2b T C 11: 97,732,716 M67V possibly damaging Het
Polq C A 16: 37,089,353 Y2366* probably null Het
Prg3 T C 2: 84,988,753 S8P probably benign Het
Prl7c1 A T 13: 27,778,969 L17* probably null Het
Prl8a8 A T 13: 27,511,496 S51R probably damaging Het
Pttg1 G C 11: 43,421,149 P160A probably benign Het
Rbfox1 C A 16: 7,353,003 R276S possibly damaging Het
Rnase2a T G 14: 51,255,531 M126L probably benign Het
Secisbp2 A T 13: 51,656,907 K202* probably null Het
Sema6c A G 3: 95,168,845 H236R possibly damaging Het
Sept12 A G 16: 4,991,993 L181P probably damaging Het
Shc3 A T 13: 51,431,205 V458D possibly damaging Het
Tecta A G 9: 42,366,943 Y1090H probably benign Het
Thsd7a A T 6: 12,379,430 N998K Het
Tmem131l A T 3: 83,919,459 S1184T possibly damaging Het
Tnfsf15 T C 4: 63,729,650 D251G probably damaging Het
Ttyh3 T C 5: 140,629,785 E348G probably benign Het
Unc5c T C 3: 141,733,904 L186P probably damaging Het
Vmn2r37 A T 7: 9,216,046 N446K probably damaging Het
Vmn2r63 T C 7: 42,928,535 D193G possibly damaging Het
Vmn2r85 A T 10: 130,426,507 M121K probably benign Het
Vmn2r88 A G 14: 51,413,796 D189G Het
Vwc2l C A 1: 70,729,093 C105* probably null Het
Wdr72 T A 9: 74,148,315 D275E probably damaging Het
Zfhx4 A T 3: 5,402,489 D2594V probably damaging Het
Zfp174 C T 16: 3,854,405 H273Y probably benign Het
Zwilch A G 9: 64,161,376 S203P probably damaging Het
Other mutations in Nlrp4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00727:Nlrp4c APN 7 6066702 missense possibly damaging 0.80
IGL01458:Nlrp4c APN 7 6100784 missense possibly damaging 0.94
IGL01464:Nlrp4c APN 7 6100784 missense possibly damaging 0.94
IGL01470:Nlrp4c APN 7 6100784 missense possibly damaging 0.94
IGL01481:Nlrp4c APN 7 6100784 missense possibly damaging 0.94
IGL01531:Nlrp4c APN 7 6060656 missense probably damaging 1.00
IGL01595:Nlrp4c APN 7 6066112 nonsense probably null
IGL02087:Nlrp4c APN 7 6092583 missense probably damaging 1.00
IGL02226:Nlrp4c APN 7 6066829 missense possibly damaging 0.78
IGL02588:Nlrp4c APN 7 6084648 missense probably benign 0.25
IGL02822:Nlrp4c APN 7 6065727 missense probably damaging 1.00
IGL02884:Nlrp4c APN 7 6098952 missense probably damaging 1.00
IGL02943:Nlrp4c APN 7 6065975 missense probably damaging 0.96
IGL03017:Nlrp4c APN 7 6084680 missense probably benign 0.23
R0347:Nlrp4c UTSW 7 6066416 missense possibly damaging 0.69
R0579:Nlrp4c UTSW 7 6060845 missense probably benign 0.05
R1051:Nlrp4c UTSW 7 6065943 missense probably benign 0.01
R1596:Nlrp4c UTSW 7 6066778 missense probably benign
R1636:Nlrp4c UTSW 7 6066738 missense possibly damaging 0.64
R1739:Nlrp4c UTSW 7 6073222 missense probably damaging 1.00
R1766:Nlrp4c UTSW 7 6073114 missense probably benign 0.00
R1824:Nlrp4c UTSW 7 6066956 splice site probably null
R1827:Nlrp4c UTSW 7 6065766 missense probably damaging 1.00
R1858:Nlrp4c UTSW 7 6084656 missense probably benign 0.02
R1902:Nlrp4c UTSW 7 6065819 missense probably damaging 0.98
R2217:Nlrp4c UTSW 7 6073114 missense probably benign
R2415:Nlrp4c UTSW 7 6066048 missense probably damaging 1.00
R3004:Nlrp4c UTSW 7 6065525 missense probably benign 0.28
R3005:Nlrp4c UTSW 7 6065525 missense probably benign 0.28
R3410:Nlrp4c UTSW 7 6092570 missense possibly damaging 0.69
R3411:Nlrp4c UTSW 7 6092570 missense possibly damaging 0.69
R3710:Nlrp4c UTSW 7 6065628 missense probably damaging 0.99
R4072:Nlrp4c UTSW 7 6072710 missense probably benign 0.00
R4073:Nlrp4c UTSW 7 6072710 missense probably benign 0.00
R4075:Nlrp4c UTSW 7 6072710 missense probably benign 0.00
R4076:Nlrp4c UTSW 7 6072710 missense probably benign 0.00
R4542:Nlrp4c UTSW 7 6100827 nonsense probably null
R4709:Nlrp4c UTSW 7 6065425 missense probably benign 0.31
R4776:Nlrp4c UTSW 7 6066126 missense probably benign 0.41
R5043:Nlrp4c UTSW 7 6066825 missense probably benign 0.01
R5258:Nlrp4c UTSW 7 6066623 missense probably benign 0.06
R6164:Nlrp4c UTSW 7 6092508 missense probably damaging 1.00
R6383:Nlrp4c UTSW 7 6066053 missense probably benign
R6650:Nlrp4c UTSW 7 6065949 missense probably damaging 0.99
R6810:Nlrp4c UTSW 7 6066755 missense probably damaging 1.00
R7095:Nlrp4c UTSW 7 6060793 missense probably damaging 0.97
R7102:Nlrp4c UTSW 7 6065709 nonsense probably null
R7232:Nlrp4c UTSW 7 6065709 nonsense probably null
R7444:Nlrp4c UTSW 7 6092596 nonsense probably null
R7705:Nlrp4c UTSW 7 6072636 missense probably damaging 0.97
R7966:Nlrp4c UTSW 7 6066323 missense probably damaging 0.99
R8506:Nlrp4c UTSW 7 6100776 missense possibly damaging 0.47
R8677:Nlrp4c UTSW 7 6072645 missense probably damaging 0.99
R8708:Nlrp4c UTSW 7 6065604 missense probably damaging 1.00
R8838:Nlrp4c UTSW 7 6066338 missense
X0060:Nlrp4c UTSW 7 6065918 missense probably damaging 1.00
Z1088:Nlrp4c UTSW 7 6066636 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACATGGTGTTCCTGCAAGG -3'
(R):5'- CAAAAGTCTCTGGGGTAGCAG -3'

Sequencing Primer
(F):5'- GAGCAGCGGGAATTGGC -3'
(R):5'- AAGAGGATTTGGGGAGCATCTTCC -3'
Posted On2019-05-15