Incidental Mutation 'R7104:Drc7'
ID551057
Institutional Source Beutler Lab
Gene Symbol Drc7
Ensembl Gene ENSMUSG00000031786
Gene Namedynein regulatory complex subunit 7
SynonymsSRG-L, LOC330830, Ccdc135
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7104 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location95055103-95078141 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95059083 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 189 (D189G)
Ref Sequence ENSEMBL: ENSMUSP00000053972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058479]
Predicted Effect probably damaging
Transcript: ENSMUST00000058479
AA Change: D189G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000053972
Gene: ENSMUSG00000031786
AA Change: D189G

DomainStartEndE-ValueType
coiled coil region 1 33 N/A INTRINSIC
low complexity region 229 246 N/A INTRINSIC
coiled coil region 258 295 N/A INTRINSIC
low complexity region 388 411 N/A INTRINSIC
low complexity region 544 555 N/A INTRINSIC
low complexity region 695 710 N/A INTRINSIC
low complexity region 798 809 N/A INTRINSIC
low complexity region 848 864 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,194,444 L897P possibly damaging Het
Agbl2 A G 2: 90,797,547 E232G probably damaging Het
Atf7 A G 15: 102,534,235 S480P probably benign Het
Cdk14 A G 5: 5,195,325 I166T possibly damaging Het
Cdk5rap2 G T 4: 70,349,156 F358L probably benign Het
Cytip A G 2: 58,159,974 S28P probably benign Het
Dennd5b C T 6: 149,044,604 R503Q probably damaging Het
Dnajc10 T A 2: 80,340,815 C480S probably damaging Het
Engase G A 11: 118,481,295 V138M probably damaging Het
Esyt3 C A 9: 99,338,787 R121L probably damaging Het
Frem1 T G 4: 82,940,681 I1516L probably benign Het
Gatad2b T A 3: 90,351,417 I249N probably damaging Het
Grk6 T C 13: 55,454,406 S383P probably benign Het
Hectd1 C T 12: 51,827,351 probably null Het
Hipk2 A G 6: 38,818,644 L230P probably damaging Het
Hivep1 A T 13: 42,157,338 Q1018L probably benign Het
Itgad T C 7: 128,198,378 F927S probably benign Het
Itgb3bp A G 4: 99,814,098 V3A probably damaging Het
Kcnh7 G T 2: 62,787,687 A486D possibly damaging Het
Krt2 T C 15: 101,815,087 T318A probably benign Het
Ndrg1 A G 15: 66,946,528 F77S probably damaging Het
Nlrp4c T A 7: 6,065,709 L203* probably null Het
Nos1 T A 5: 117,947,431 C1275S probably damaging Het
Olfr1052 T A 2: 86,298,220 S135T probably benign Het
Olfr1167 T C 2: 88,149,372 T216A possibly damaging Het
Olfr1241 A G 2: 89,483,114 V7A possibly damaging Het
Olfr1431 T C 19: 12,209,878 I104T possibly damaging Het
Olfr294 T C 7: 86,615,692 S318G probably null Het
Olfr875 A T 9: 37,773,141 N161Y possibly damaging Het
Pip4k2b T C 11: 97,732,716 M67V possibly damaging Het
Polq C A 16: 37,089,353 Y2366* probably null Het
Prg3 T C 2: 84,988,753 S8P probably benign Het
Prl7c1 A T 13: 27,778,969 L17* probably null Het
Prl8a8 A T 13: 27,511,496 S51R probably damaging Het
Pttg1 G C 11: 43,421,149 P160A probably benign Het
Rbfox1 C A 16: 7,353,003 R276S possibly damaging Het
Rnase2a T G 14: 51,255,531 M126L probably benign Het
Secisbp2 A T 13: 51,656,907 K202* probably null Het
Sema6c A G 3: 95,168,845 H236R possibly damaging Het
Sept12 A G 16: 4,991,993 L181P probably damaging Het
Shc3 A T 13: 51,431,205 V458D possibly damaging Het
Tecta A G 9: 42,366,943 Y1090H probably benign Het
Thsd7a A T 6: 12,379,430 N998K Het
Tmem131l A T 3: 83,919,459 S1184T possibly damaging Het
Tnfsf15 T C 4: 63,729,650 D251G probably damaging Het
Ttyh3 T C 5: 140,629,785 E348G probably benign Het
Unc5c T C 3: 141,733,904 L186P probably damaging Het
Vmn2r37 A T 7: 9,216,046 N446K probably damaging Het
Vmn2r63 T C 7: 42,928,535 D193G possibly damaging Het
Vmn2r85 A T 10: 130,426,507 M121K probably benign Het
Vmn2r88 A G 14: 51,413,796 D189G Het
Vwc2l C A 1: 70,729,093 C105* probably null Het
Wdr72 T A 9: 74,148,315 D275E probably damaging Het
Zfhx4 A T 3: 5,402,489 D2594V probably damaging Het
Zfp174 C T 16: 3,854,405 H273Y probably benign Het
Zwilch A G 9: 64,161,376 S203P probably damaging Het
Other mutations in Drc7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Drc7 APN 8 95056001 splice site probably benign
IGL00922:Drc7 APN 8 95077978 missense probably benign 0.00
IGL01610:Drc7 APN 8 95077802 missense probably damaging 1.00
IGL01642:Drc7 APN 8 95059139 missense probably benign 0.34
IGL01793:Drc7 APN 8 95071277 missense probably benign 0.25
IGL01936:Drc7 APN 8 95074132 missense possibly damaging 0.89
IGL01953:Drc7 APN 8 95059125 missense probably damaging 1.00
IGL01998:Drc7 APN 8 95059193 missense probably damaging 1.00
IGL02237:Drc7 APN 8 95072879 missense probably damaging 1.00
IGL02259:Drc7 APN 8 95056105 missense probably benign
IGL02285:Drc7 APN 8 95071233 splice site probably benign
IGL02940:Drc7 APN 8 95074297 missense probably damaging 0.99
IGL03032:Drc7 APN 8 95076247 splice site probably benign
IGL03181:Drc7 APN 8 95068127 missense probably benign 0.00
R0018:Drc7 UTSW 8 95074234 missense probably damaging 0.99
R0018:Drc7 UTSW 8 95074234 missense probably damaging 0.99
R0281:Drc7 UTSW 8 95071253 missense possibly damaging 0.61
R0304:Drc7 UTSW 8 95059128 missense probably damaging 1.00
R0362:Drc7 UTSW 8 95072855 missense probably benign 0.00
R1127:Drc7 UTSW 8 95072788 missense probably damaging 0.98
R1635:Drc7 UTSW 8 95074332 critical splice donor site probably null
R1921:Drc7 UTSW 8 95056016 missense unknown
R1931:Drc7 UTSW 8 95071253 missense possibly damaging 0.61
R2256:Drc7 UTSW 8 95075009 missense probably benign 0.16
R3851:Drc7 UTSW 8 95061836 nonsense probably null
R4797:Drc7 UTSW 8 95074297 missense probably damaging 0.96
R4827:Drc7 UTSW 8 95071639 missense probably damaging 0.98
R4966:Drc7 UTSW 8 95071596 missense probably benign 0.45
R5194:Drc7 UTSW 8 95061717 missense probably benign 0.00
R5721:Drc7 UTSW 8 95074333 critical splice donor site probably null
R5911:Drc7 UTSW 8 95074126 missense probably damaging 1.00
R5993:Drc7 UTSW 8 95074192 missense probably benign
R6056:Drc7 UTSW 8 95075051 missense probably damaging 1.00
R6534:Drc7 UTSW 8 95071282 missense probably damaging 1.00
R6576:Drc7 UTSW 8 95075258 missense probably damaging 0.98
R6861:Drc7 UTSW 8 95062397 critical splice donor site probably null
R7157:Drc7 UTSW 8 95074150 missense probably damaging 0.99
R7205:Drc7 UTSW 8 95077921 missense probably damaging 1.00
R7283:Drc7 UTSW 8 95071579 missense probably damaging 0.99
R7351:Drc7 UTSW 8 95058507 missense probably benign 0.25
R7567:Drc7 UTSW 8 95068056 missense probably benign 0.00
R8211:Drc7 UTSW 8 95056079 missense unknown
R8281:Drc7 UTSW 8 95062177 missense possibly damaging 0.81
R8401:Drc7 UTSW 8 95074135 missense probably benign
R8821:Drc7 UTSW 8 95062217 missense probably damaging 1.00
R8831:Drc7 UTSW 8 95062217 missense probably damaging 1.00
Y5404:Drc7 UTSW 8 95068150 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TGTTTGTGGCACATCCTCAAGAG -3'
(R):5'- ATAGTCAGAGCAGTGCCCTG -3'

Sequencing Primer
(F):5'- CTCAAGAGGCTCTGGATGCAAC -3'
(R):5'- GCCCTGATCTCCTAAGATGGATG -3'
Posted On2019-05-15