Incidental Mutation 'R7104:Tecta'
ID 551059
Institutional Source Beutler Lab
Gene Symbol Tecta
Ensembl Gene ENSMUSG00000037705
Gene Name tectorin alpha
Synonyms [a]-tectorin, Tctna
MMRRC Submission 045196-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.107) question?
Stock # R7104 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 42240915-42311225 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 42278239 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 1090 (Y1090H)
Ref Sequence ENSEMBL: ENSMUSP00000040262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042190] [ENSMUST00000160940]
AlphaFold O08523
Predicted Effect probably benign
Transcript: ENSMUST00000042190
AA Change: Y1090H

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000040262
Gene: ENSMUSG00000037705
AA Change: Y1090H

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
NIDO 98 254 7.88e-77 SMART
VWC 260 314 1.04e0 SMART
VWD 312 477 1.5e-58 SMART
C8 517 592 7.06e-29 SMART
EGF_like 622 645 3.87e1 SMART
VWC 652 713 1.87e-1 SMART
VWD 703 865 4.44e-43 SMART
C8 905 981 9.19e-19 SMART
Pfam:TIL 984 1036 9.8e-13 PFAM
VWD 1090 1257 1.44e-51 SMART
C8 1294 1369 4.64e-15 SMART
EGF_like 1388 1420 5.34e1 SMART
VWC 1427 1487 2.88e-19 SMART
VWD 1477 1638 2.72e-38 SMART
C8 1684 1758 6.51e-10 SMART
ZP 1805 2059 2.95e-85 SMART
EGF 2087 2122 2.07e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160940
AA Change: Y1090H

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000125370
Gene: ENSMUSG00000037705
AA Change: Y1090H

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
NIDO 98 254 7.88e-77 SMART
VWC 260 314 1.04e0 SMART
VWD 312 477 1.5e-58 SMART
C8 517 592 7.06e-29 SMART
EGF_like 622 645 3.87e1 SMART
VWC 652 713 1.87e-1 SMART
VWD 703 865 4.44e-43 SMART
C8 905 981 9.19e-19 SMART
Pfam:TIL 984 1036 6.1e-13 PFAM
VWD 1090 1257 1.44e-51 SMART
C8 1294 1369 4.64e-15 SMART
EGF_like 1388 1420 5.34e1 SMART
VWC 1427 1487 2.88e-19 SMART
VWD 1477 1638 2.72e-38 SMART
C8 1679 1753 6.51e-10 SMART
ZP 1800 2054 2.95e-85 SMART
EGF 2082 2117 2.07e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The tectorial membrane is an extracellular matrix of the inner ear that contacts the stereocilia bundles of specialized sensory hair cells. Sound induces movement of these hair cells relative to the tectorial membrane, deflects the stereocilia, and leads to fluctuations in hair-cell membrane potential, transducing sound into electrical signals. Alpha-tectorin is one of the major noncollagenous components of the tectorial membrane. Mutations in the TECTA gene have been shown to be responsible for autosomal dominant nonsyndromic hearing impairment and a recessive form of sensorineural pre-lingual non-syndromic deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit a tectorial membrane that is detached from the cochlear epithelium. Though the basilar membranes of mutant mice are tuned, sensitivity is attenuated. Mice with an Y1870C mutation have a disrupted tectorial membrane, elevated neural thresholds and broadened neural tuning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl2 A G 2: 90,627,891 (GRCm39) E232G probably damaging Het
Atf7 A G 15: 102,442,670 (GRCm39) S480P probably benign Het
Cdk14 A G 5: 5,245,325 (GRCm39) I166T possibly damaging Het
Cdk5rap2 G T 4: 70,267,393 (GRCm39) F358L probably benign Het
Cplane1 T C 15: 8,223,928 (GRCm39) L897P possibly damaging Het
Cytip A G 2: 58,049,986 (GRCm39) S28P probably benign Het
Dennd5b C T 6: 148,946,102 (GRCm39) R503Q probably damaging Het
Dnajc10 T A 2: 80,171,159 (GRCm39) C480S probably damaging Het
Drc7 A G 8: 95,785,711 (GRCm39) D189G probably damaging Het
Engase G A 11: 118,372,121 (GRCm39) V138M probably damaging Het
Esyt3 C A 9: 99,220,840 (GRCm39) R121L probably damaging Het
Frem1 T G 4: 82,858,918 (GRCm39) I1516L probably benign Het
Gatad2b T A 3: 90,258,724 (GRCm39) I249N probably damaging Het
Grk6 T C 13: 55,602,219 (GRCm39) S383P probably benign Het
Hectd1 C T 12: 51,874,134 (GRCm39) probably null Het
Hipk2 A G 6: 38,795,579 (GRCm39) L230P probably damaging Het
Hivep1 A T 13: 42,310,814 (GRCm39) Q1018L probably benign Het
Itgad T C 7: 127,797,550 (GRCm39) F927S probably benign Het
Itgb3bp A G 4: 99,702,335 (GRCm39) V3A probably damaging Het
Kcnh7 G T 2: 62,618,031 (GRCm39) A486D possibly damaging Het
Krt1c T C 15: 101,723,522 (GRCm39) T318A probably benign Het
Ndrg1 A G 15: 66,818,377 (GRCm39) F77S probably damaging Het
Nlrp4c T A 7: 6,068,708 (GRCm39) L203* probably null Het
Nos1 T A 5: 118,085,496 (GRCm39) C1275S probably damaging Het
Or14a256 T C 7: 86,264,900 (GRCm39) S318G probably null Het
Or4a69 A G 2: 89,313,458 (GRCm39) V7A possibly damaging Het
Or5an9 T C 19: 12,187,242 (GRCm39) I104T possibly damaging Het
Or5d39 T C 2: 87,979,716 (GRCm39) T216A possibly damaging Het
Or5j3 T A 2: 86,128,564 (GRCm39) S135T probably benign Het
Or8b12b A T 9: 37,684,437 (GRCm39) N161Y possibly damaging Het
Pip4k2b T C 11: 97,623,542 (GRCm39) M67V possibly damaging Het
Polq C A 16: 36,909,715 (GRCm39) Y2366* probably null Het
Prg3 T C 2: 84,819,097 (GRCm39) S8P probably benign Het
Prl7c1 A T 13: 27,962,952 (GRCm39) L17* probably null Het
Prl8a8 A T 13: 27,695,479 (GRCm39) S51R probably damaging Het
Pttg1 G C 11: 43,311,976 (GRCm39) P160A probably benign Het
Rbfox1 C A 16: 7,170,867 (GRCm39) R276S possibly damaging Het
Rnase2a T G 14: 51,492,988 (GRCm39) M126L probably benign Het
Secisbp2 A T 13: 51,810,943 (GRCm39) K202* probably null Het
Sema6c A G 3: 95,076,156 (GRCm39) H236R possibly damaging Het
Septin12 A G 16: 4,809,857 (GRCm39) L181P probably damaging Het
Shc3 A T 13: 51,585,241 (GRCm39) V458D possibly damaging Het
Thsd7a A T 6: 12,379,429 (GRCm39) N998K Het
Tmem131l A T 3: 83,826,766 (GRCm39) S1184T possibly damaging Het
Tnfsf15 T C 4: 63,647,887 (GRCm39) D251G probably damaging Het
Ttyh3 T C 5: 140,615,540 (GRCm39) E348G probably benign Het
Unc5c T C 3: 141,439,665 (GRCm39) L186P probably damaging Het
Vmn2r37 A T 7: 9,219,045 (GRCm39) N446K probably damaging Het
Vmn2r63 T C 7: 42,577,959 (GRCm39) D193G possibly damaging Het
Vmn2r85 A T 10: 130,262,376 (GRCm39) M121K probably benign Het
Vmn2r88 A G 14: 51,651,253 (GRCm39) D189G Het
Vwc2l C A 1: 70,768,252 (GRCm39) C105* probably null Het
Wdr72 T A 9: 74,055,597 (GRCm39) D275E probably damaging Het
Zfhx4 A T 3: 5,467,549 (GRCm39) D2594V probably damaging Het
Zfp174 C T 16: 3,672,269 (GRCm39) H273Y probably benign Het
Zwilch A G 9: 64,068,658 (GRCm39) S203P probably damaging Het
Other mutations in Tecta
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Tecta APN 9 42,243,844 (GRCm39) missense probably damaging 1.00
IGL00925:Tecta APN 9 42,286,331 (GRCm39) missense probably benign
IGL00960:Tecta APN 9 42,270,376 (GRCm39) missense possibly damaging 0.74
IGL00974:Tecta APN 9 42,242,670 (GRCm39) missense probably benign 0.00
IGL01070:Tecta APN 9 42,306,299 (GRCm39) missense probably damaging 1.00
IGL01284:Tecta APN 9 42,256,916 (GRCm39) missense probably damaging 1.00
IGL01324:Tecta APN 9 42,256,727 (GRCm39) missense probably damaging 1.00
IGL01694:Tecta APN 9 42,278,475 (GRCm39) missense possibly damaging 0.92
IGL01861:Tecta APN 9 42,284,658 (GRCm39) missense probably benign
IGL02010:Tecta APN 9 42,248,489 (GRCm39) missense probably damaging 0.97
IGL02397:Tecta APN 9 42,306,294 (GRCm39) missense probably damaging 1.00
IGL03031:Tecta APN 9 42,256,789 (GRCm39) missense probably benign
IGL03208:Tecta APN 9 42,248,396 (GRCm39) splice site probably benign
IGL03249:Tecta APN 9 42,303,182 (GRCm39) missense probably benign 0.20
cover UTSW 9 42,255,183 (GRCm39) missense probably benign 0.05
lid UTSW 9 42,284,406 (GRCm39) missense probably damaging 0.99
R0004:Tecta UTSW 9 42,256,774 (GRCm39) missense possibly damaging 0.74
R0045:Tecta UTSW 9 42,286,487 (GRCm39) missense probably damaging 1.00
R0045:Tecta UTSW 9 42,286,487 (GRCm39) missense probably damaging 1.00
R0119:Tecta UTSW 9 42,263,359 (GRCm39) missense probably damaging 1.00
R0133:Tecta UTSW 9 42,278,524 (GRCm39) missense probably benign 0.00
R0157:Tecta UTSW 9 42,286,307 (GRCm39) missense probably benign
R0180:Tecta UTSW 9 42,278,109 (GRCm39) missense probably benign
R0299:Tecta UTSW 9 42,263,359 (GRCm39) missense probably damaging 1.00
R0345:Tecta UTSW 9 42,295,514 (GRCm39) missense probably damaging 0.98
R0370:Tecta UTSW 9 42,278,100 (GRCm39) missense probably benign
R0465:Tecta UTSW 9 42,270,714 (GRCm39) missense possibly damaging 0.62
R0466:Tecta UTSW 9 42,284,369 (GRCm39) missense probably benign
R0479:Tecta UTSW 9 42,249,235 (GRCm39) missense probably damaging 1.00
R0498:Tecta UTSW 9 42,288,910 (GRCm39) missense probably damaging 1.00
R0499:Tecta UTSW 9 42,263,359 (GRCm39) missense probably damaging 1.00
R0519:Tecta UTSW 9 42,259,188 (GRCm39) splice site probably benign
R0584:Tecta UTSW 9 42,259,204 (GRCm39) missense possibly damaging 0.79
R0589:Tecta UTSW 9 42,256,930 (GRCm39) missense probably benign 0.01
R0607:Tecta UTSW 9 42,299,501 (GRCm39) missense probably damaging 1.00
R0691:Tecta UTSW 9 42,295,637 (GRCm39) missense probably damaging 1.00
R0905:Tecta UTSW 9 42,250,290 (GRCm39) missense probably damaging 1.00
R1216:Tecta UTSW 9 42,289,203 (GRCm39) missense probably benign 0.44
R1239:Tecta UTSW 9 42,243,781 (GRCm39) missense probably damaging 1.00
R1442:Tecta UTSW 9 42,243,778 (GRCm39) missense probably damaging 1.00
R1553:Tecta UTSW 9 42,259,482 (GRCm39) missense probably damaging 1.00
R1727:Tecta UTSW 9 42,270,597 (GRCm39) missense probably damaging 0.96
R1728:Tecta UTSW 9 42,303,218 (GRCm39) missense probably benign 0.12
R1729:Tecta UTSW 9 42,303,218 (GRCm39) missense probably benign 0.12
R1762:Tecta UTSW 9 42,286,605 (GRCm39) missense probably benign 0.30
R1778:Tecta UTSW 9 42,254,927 (GRCm39) missense probably damaging 1.00
R1795:Tecta UTSW 9 42,289,345 (GRCm39) missense probably benign
R1796:Tecta UTSW 9 42,295,493 (GRCm39) missense probably damaging 1.00
R1866:Tecta UTSW 9 42,303,320 (GRCm39) missense probably damaging 0.97
R1871:Tecta UTSW 9 42,248,636 (GRCm39) missense probably damaging 1.00
R1871:Tecta UTSW 9 42,248,472 (GRCm39) missense probably damaging 0.98
R1911:Tecta UTSW 9 42,249,232 (GRCm39) missense probably damaging 1.00
R2074:Tecta UTSW 9 42,248,575 (GRCm39) nonsense probably null
R2135:Tecta UTSW 9 42,251,581 (GRCm39) missense probably damaging 1.00
R2171:Tecta UTSW 9 42,270,220 (GRCm39) missense probably damaging 0.99
R2220:Tecta UTSW 9 42,303,326 (GRCm39) missense probably damaging 1.00
R2372:Tecta UTSW 9 42,299,570 (GRCm39) missense probably damaging 1.00
R2570:Tecta UTSW 9 42,243,848 (GRCm39) missense probably damaging 1.00
R2939:Tecta UTSW 9 42,289,290 (GRCm39) missense possibly damaging 0.63
R2940:Tecta UTSW 9 42,289,290 (GRCm39) missense possibly damaging 0.63
R3081:Tecta UTSW 9 42,289,290 (GRCm39) missense possibly damaging 0.63
R3407:Tecta UTSW 9 42,249,150 (GRCm39) missense probably damaging 1.00
R3732:Tecta UTSW 9 42,303,402 (GRCm39) missense possibly damaging 0.95
R3771:Tecta UTSW 9 42,242,292 (GRCm39) missense probably damaging 1.00
R3772:Tecta UTSW 9 42,242,292 (GRCm39) missense probably damaging 1.00
R3773:Tecta UTSW 9 42,242,292 (GRCm39) missense probably damaging 1.00
R3832:Tecta UTSW 9 42,250,329 (GRCm39) missense probably damaging 1.00
R4378:Tecta UTSW 9 42,278,004 (GRCm39) missense probably damaging 1.00
R4480:Tecta UTSW 9 42,284,529 (GRCm39) missense possibly damaging 0.75
R4485:Tecta UTSW 9 42,248,570 (GRCm39) missense possibly damaging 0.73
R4804:Tecta UTSW 9 42,309,533 (GRCm39) missense probably benign
R4869:Tecta UTSW 9 42,286,830 (GRCm39) missense probably benign 0.02
R4944:Tecta UTSW 9 42,241,573 (GRCm39) missense probably benign 0.05
R5008:Tecta UTSW 9 42,284,358 (GRCm39) missense possibly damaging 0.76
R5014:Tecta UTSW 9 42,284,538 (GRCm39) missense probably damaging 1.00
R5125:Tecta UTSW 9 42,286,481 (GRCm39) missense probably damaging 1.00
R5178:Tecta UTSW 9 42,286,481 (GRCm39) missense probably damaging 1.00
R5180:Tecta UTSW 9 42,248,504 (GRCm39) missense probably damaging 1.00
R5214:Tecta UTSW 9 42,256,964 (GRCm39) missense probably benign 0.04
R5230:Tecta UTSW 9 42,306,239 (GRCm39) missense probably damaging 0.96
R5330:Tecta UTSW 9 42,249,152 (GRCm39) missense probably damaging 1.00
R5387:Tecta UTSW 9 42,286,359 (GRCm39) missense probably damaging 0.98
R5614:Tecta UTSW 9 42,250,351 (GRCm39) missense probably damaging 1.00
R5708:Tecta UTSW 9 42,250,222 (GRCm39) missense probably damaging 1.00
R5738:Tecta UTSW 9 42,284,474 (GRCm39) missense possibly damaging 0.63
R5770:Tecta UTSW 9 42,256,885 (GRCm39) missense possibly damaging 0.94
R5839:Tecta UTSW 9 42,284,272 (GRCm39) missense possibly damaging 0.86
R5839:Tecta UTSW 9 42,242,319 (GRCm39) missense probably benign 0.03
R6119:Tecta UTSW 9 42,284,371 (GRCm39) missense probably benign 0.00
R6246:Tecta UTSW 9 42,289,204 (GRCm39) missense probably benign 0.07
R6377:Tecta UTSW 9 42,255,051 (GRCm39) missense probably damaging 1.00
R6416:Tecta UTSW 9 42,286,563 (GRCm39) missense probably damaging 0.97
R6595:Tecta UTSW 9 42,295,523 (GRCm39) missense probably damaging 1.00
R6850:Tecta UTSW 9 42,255,134 (GRCm39) missense probably benign 0.20
R6859:Tecta UTSW 9 42,303,425 (GRCm39) missense probably damaging 1.00
R6861:Tecta UTSW 9 42,248,633 (GRCm39) missense possibly damaging 0.93
R6939:Tecta UTSW 9 42,259,293 (GRCm39) missense probably damaging 1.00
R6996:Tecta UTSW 9 42,278,082 (GRCm39) missense probably benign
R7069:Tecta UTSW 9 42,306,237 (GRCm39) missense probably benign 0.03
R7129:Tecta UTSW 9 42,259,287 (GRCm39) missense probably damaging 1.00
R7220:Tecta UTSW 9 42,255,183 (GRCm39) missense probably benign 0.05
R7251:Tecta UTSW 9 42,299,048 (GRCm39) missense probably damaging 1.00
R7307:Tecta UTSW 9 42,289,288 (GRCm39) missense probably damaging 1.00
R7343:Tecta UTSW 9 42,248,628 (GRCm39) missense probably damaging 1.00
R7355:Tecta UTSW 9 42,278,438 (GRCm39) nonsense probably null
R7635:Tecta UTSW 9 42,242,283 (GRCm39) missense probably benign 0.11
R7653:Tecta UTSW 9 42,248,532 (GRCm39) missense probably damaging 1.00
R7723:Tecta UTSW 9 42,278,232 (GRCm39) missense probably damaging 1.00
R7939:Tecta UTSW 9 42,299,519 (GRCm39) missense probably damaging 0.99
R7966:Tecta UTSW 9 42,306,258 (GRCm39) missense probably damaging 0.98
R7967:Tecta UTSW 9 42,289,251 (GRCm39) missense possibly damaging 0.95
R8000:Tecta UTSW 9 42,278,480 (GRCm39) nonsense probably null
R8064:Tecta UTSW 9 42,306,251 (GRCm39) missense possibly damaging 0.94
R8117:Tecta UTSW 9 42,288,927 (GRCm39) missense probably damaging 1.00
R8176:Tecta UTSW 9 42,270,465 (GRCm39) missense probably damaging 0.97
R8284:Tecta UTSW 9 42,289,325 (GRCm39) missense possibly damaging 0.89
R8315:Tecta UTSW 9 42,299,121 (GRCm39) critical splice acceptor site probably null
R8321:Tecta UTSW 9 42,284,349 (GRCm39) missense probably damaging 1.00
R8332:Tecta UTSW 9 42,286,310 (GRCm39) missense probably damaging 1.00
R8437:Tecta UTSW 9 42,243,856 (GRCm39) missense probably damaging 0.98
R8496:Tecta UTSW 9 42,241,547 (GRCm39) missense probably benign 0.01
R8514:Tecta UTSW 9 42,284,406 (GRCm39) missense probably damaging 0.99
R8683:Tecta UTSW 9 42,278,268 (GRCm39) missense probably damaging 0.96
R8856:Tecta UTSW 9 42,284,597 (GRCm39) missense probably benign 0.13
R8886:Tecta UTSW 9 42,278,359 (GRCm39) missense probably benign 0.37
R9047:Tecta UTSW 9 42,286,375 (GRCm39) missense probably benign 0.00
R9106:Tecta UTSW 9 42,278,479 (GRCm39) missense probably benign 0.05
R9332:Tecta UTSW 9 42,284,193 (GRCm39) missense probably damaging 1.00
R9352:Tecta UTSW 9 42,249,147 (GRCm39) missense probably damaging 1.00
R9462:Tecta UTSW 9 42,248,576 (GRCm39) missense probably damaging 1.00
R9535:Tecta UTSW 9 42,270,759 (GRCm39) missense probably damaging 0.99
R9564:Tecta UTSW 9 42,249,123 (GRCm39) missense probably damaging 0.97
R9592:Tecta UTSW 9 42,250,238 (GRCm39) missense probably damaging 1.00
R9715:Tecta UTSW 9 42,286,596 (GRCm39) missense probably damaging 1.00
Z1176:Tecta UTSW 9 42,303,390 (GRCm39) missense probably damaging 0.99
Z1177:Tecta UTSW 9 42,286,872 (GRCm39) missense probably benign 0.00
Z1177:Tecta UTSW 9 42,303,366 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACCCACAAGGCTAGAGATGG -3'
(R):5'- TGAAGGTTATGCCCTGCAGG -3'

Sequencing Primer
(F):5'- CACAAGGCTAGAGATGGGTCCC -3'
(R):5'- AGGGCAGCCAGTGTGTC -3'
Posted On 2019-05-15