Incidental Mutation 'R7104:Zwilch'
ID551060
Institutional Source Beutler Lab
Gene Symbol Zwilch
Ensembl Gene ENSMUSG00000032400
Gene Namezwilch kinetochore protein
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7104 (G1)
Quality Score211.009
Status Not validated
Chromosome9
Chromosomal Location64137144-64173104 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64161376 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 203 (S203P)
Ref Sequence ENSEMBL: ENSMUSP00000112790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122091] [ENSMUST00000130127] [ENSMUST00000176299] [ENSMUST00000176378] [ENSMUST00000176794] [ENSMUST00000177045]
Predicted Effect probably damaging
Transcript: ENSMUST00000122091
AA Change: S203P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112790
Gene: ENSMUSG00000032400
AA Change: S203P

DomainStartEndE-ValueType
Pfam:DUF2352 38 589 6e-206 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124301
SMART Domains Protein: ENSMUSP00000134966
Gene: ENSMUSG00000032400

DomainStartEndE-ValueType
PDB:3IF8|A 3 74 3e-31 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000130127
SMART Domains Protein: ENSMUSP00000116187
Gene: ENSMUSG00000032400

DomainStartEndE-ValueType
Pfam:DUF2352 72 154 8e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176299
AA Change: S82P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135585
Gene: ENSMUSG00000032400
AA Change: S82P

DomainStartEndE-ValueType
Pfam:DUF2352 1 471 2.9e-192 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176378
SMART Domains Protein: ENSMUSP00000134782
Gene: ENSMUSG00000032400

DomainStartEndE-ValueType
PDB:3IF8|A 3 74 1e-31 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000176794
AA Change: S203P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134850
Gene: ENSMUSG00000032400
AA Change: S203P

DomainStartEndE-ValueType
Pfam:DUF2352 38 257 8e-67 PFAM
Pfam:DUF2352 254 568 4.4e-131 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177045
AA Change: S184P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135328
Gene: ENSMUSG00000032400
AA Change: S184P

DomainStartEndE-ValueType
Pfam:DUF2352 19 303 2.2e-93 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,194,444 L897P possibly damaging Het
Agbl2 A G 2: 90,797,547 E232G probably damaging Het
Atf7 A G 15: 102,534,235 S480P probably benign Het
Cdk14 A G 5: 5,195,325 I166T possibly damaging Het
Cdk5rap2 G T 4: 70,349,156 F358L probably benign Het
Cytip A G 2: 58,159,974 S28P probably benign Het
Dennd5b C T 6: 149,044,604 R503Q probably damaging Het
Dnajc10 T A 2: 80,340,815 C480S probably damaging Het
Drc7 A G 8: 95,059,083 D189G probably damaging Het
Engase G A 11: 118,481,295 V138M probably damaging Het
Esyt3 C A 9: 99,338,787 R121L probably damaging Het
Frem1 T G 4: 82,940,681 I1516L probably benign Het
Gatad2b T A 3: 90,351,417 I249N probably damaging Het
Grk6 T C 13: 55,454,406 S383P probably benign Het
Hectd1 C T 12: 51,827,351 probably null Het
Hipk2 A G 6: 38,818,644 L230P probably damaging Het
Hivep1 A T 13: 42,157,338 Q1018L probably benign Het
Itgad T C 7: 128,198,378 F927S probably benign Het
Itgb3bp A G 4: 99,814,098 V3A probably damaging Het
Kcnh7 G T 2: 62,787,687 A486D possibly damaging Het
Krt2 T C 15: 101,815,087 T318A probably benign Het
Ndrg1 A G 15: 66,946,528 F77S probably damaging Het
Nlrp4c T A 7: 6,065,709 L203* probably null Het
Nos1 T A 5: 117,947,431 C1275S probably damaging Het
Olfr1052 T A 2: 86,298,220 S135T probably benign Het
Olfr1167 T C 2: 88,149,372 T216A possibly damaging Het
Olfr1241 A G 2: 89,483,114 V7A possibly damaging Het
Olfr1431 T C 19: 12,209,878 I104T possibly damaging Het
Olfr294 T C 7: 86,615,692 S318G probably null Het
Olfr875 A T 9: 37,773,141 N161Y possibly damaging Het
Pip4k2b T C 11: 97,732,716 M67V possibly damaging Het
Polq C A 16: 37,089,353 Y2366* probably null Het
Prg3 T C 2: 84,988,753 S8P probably benign Het
Prl7c1 A T 13: 27,778,969 L17* probably null Het
Prl8a8 A T 13: 27,511,496 S51R probably damaging Het
Pttg1 G C 11: 43,421,149 P160A probably benign Het
Rbfox1 C A 16: 7,353,003 R276S possibly damaging Het
Rnase2a T G 14: 51,255,531 M126L probably benign Het
Secisbp2 A T 13: 51,656,907 K202* probably null Het
Sema6c A G 3: 95,168,845 H236R possibly damaging Het
Sept12 A G 16: 4,991,993 L181P probably damaging Het
Shc3 A T 13: 51,431,205 V458D possibly damaging Het
Tecta A G 9: 42,366,943 Y1090H probably benign Het
Thsd7a A T 6: 12,379,430 N998K Het
Tmem131l A T 3: 83,919,459 S1184T possibly damaging Het
Tnfsf15 T C 4: 63,729,650 D251G probably damaging Het
Ttyh3 T C 5: 140,629,785 E348G probably benign Het
Unc5c T C 3: 141,733,904 L186P probably damaging Het
Vmn2r37 A T 7: 9,216,046 N446K probably damaging Het
Vmn2r63 T C 7: 42,928,535 D193G possibly damaging Het
Vmn2r85 A T 10: 130,426,507 M121K probably benign Het
Vmn2r88 A G 14: 51,413,796 D189G Het
Vwc2l C A 1: 70,729,093 C105* probably null Het
Wdr72 T A 9: 74,148,315 D275E probably damaging Het
Zfhx4 A T 3: 5,402,489 D2594V probably damaging Het
Zfp174 C T 16: 3,854,405 H273Y probably benign Het
Other mutations in Zwilch
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02315:Zwilch APN 9 64150267 missense probably damaging 1.00
IGL02365:Zwilch APN 9 64160924 missense probably damaging 1.00
IGL02733:Zwilch APN 9 64146836 missense probably benign 0.12
IGL02818:Zwilch APN 9 64150227 missense probably damaging 0.99
R1171:Zwilch UTSW 9 64158717 missense possibly damaging 0.56
R1913:Zwilch UTSW 9 64160952 missense probably damaging 1.00
R2079:Zwilch UTSW 9 64153574 missense probably damaging 1.00
R2079:Zwilch UTSW 9 64153575 missense probably damaging 1.00
R3772:Zwilch UTSW 9 64156034 missense probably benign 0.03
R4171:Zwilch UTSW 9 64158715 nonsense probably null
R4298:Zwilch UTSW 9 64155162 critical splice donor site probably null
R4299:Zwilch UTSW 9 64155162 critical splice donor site probably null
R4901:Zwilch UTSW 9 64162746 missense probably damaging 1.00
R5106:Zwilch UTSW 9 64153584 missense probably damaging 1.00
R5208:Zwilch UTSW 9 64152923 missense probably benign 0.00
R5215:Zwilch UTSW 9 64146874 missense probably benign
R5413:Zwilch UTSW 9 64168610 splice site probably null
R5865:Zwilch UTSW 9 64172908 start gained probably null
R6221:Zwilch UTSW 9 64161383 missense probably damaging 1.00
R6858:Zwilch UTSW 9 64153587 missense probably damaging 1.00
R6957:Zwilch UTSW 9 64162562 critical splice donor site probably null
R6995:Zwilch UTSW 9 64165449 nonsense probably null
R7691:Zwilch UTSW 9 64156091 missense probably benign 0.18
R7743:Zwilch UTSW 9 64152935 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGAGAGCAGGGGATAACT -3'
(R):5'- CCATACCAGTATGCCTAGCTATTTA -3'

Sequencing Primer
(F):5'- AACTCTGCCCTGGCTGATATAAG -3'
(R):5'- TGGAACTCACTCTATAGGCTAGGC -3'
Posted On2019-05-15