Incidental Mutation 'R7104:Esyt3'
ID 551062
Institutional Source Beutler Lab
Gene Symbol Esyt3
Ensembl Gene ENSMUSG00000037681
Gene Name extended synaptotagmin-like protein 3
Synonyms D9Ertd280e, Fam62c
MMRRC Submission 045196-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7104 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 99192016-99240610 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 99220840 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 121 (R121L)
Ref Sequence ENSEMBL: ENSMUSP00000038757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042158]
AlphaFold Q5DTI8
Predicted Effect probably damaging
Transcript: ENSMUST00000042158
AA Change: R121L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038757
Gene: ENSMUSG00000037681
AA Change: R121L

DomainStartEndE-ValueType
transmembrane domain 54 76 N/A INTRINSIC
Pfam:SMP_LBD 118 295 3.7e-63 PFAM
C2 311 411 9.23e-20 SMART
low complexity region 422 432 N/A INTRINSIC
C2 449 563 6.6e-7 SMART
low complexity region 658 673 N/A INTRINSIC
low complexity region 729 739 N/A INTRINSIC
C2 775 880 4.91e-15 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice are viable and fertile without overt morphological defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl2 A G 2: 90,627,891 (GRCm39) E232G probably damaging Het
Atf7 A G 15: 102,442,670 (GRCm39) S480P probably benign Het
Cdk14 A G 5: 5,245,325 (GRCm39) I166T possibly damaging Het
Cdk5rap2 G T 4: 70,267,393 (GRCm39) F358L probably benign Het
Cplane1 T C 15: 8,223,928 (GRCm39) L897P possibly damaging Het
Cytip A G 2: 58,049,986 (GRCm39) S28P probably benign Het
Dennd5b C T 6: 148,946,102 (GRCm39) R503Q probably damaging Het
Dnajc10 T A 2: 80,171,159 (GRCm39) C480S probably damaging Het
Drc7 A G 8: 95,785,711 (GRCm39) D189G probably damaging Het
Engase G A 11: 118,372,121 (GRCm39) V138M probably damaging Het
Frem1 T G 4: 82,858,918 (GRCm39) I1516L probably benign Het
Gatad2b T A 3: 90,258,724 (GRCm39) I249N probably damaging Het
Grk6 T C 13: 55,602,219 (GRCm39) S383P probably benign Het
Hectd1 C T 12: 51,874,134 (GRCm39) probably null Het
Hipk2 A G 6: 38,795,579 (GRCm39) L230P probably damaging Het
Hivep1 A T 13: 42,310,814 (GRCm39) Q1018L probably benign Het
Itgad T C 7: 127,797,550 (GRCm39) F927S probably benign Het
Itgb3bp A G 4: 99,702,335 (GRCm39) V3A probably damaging Het
Kcnh7 G T 2: 62,618,031 (GRCm39) A486D possibly damaging Het
Krt1c T C 15: 101,723,522 (GRCm39) T318A probably benign Het
Ndrg1 A G 15: 66,818,377 (GRCm39) F77S probably damaging Het
Nlrp4c T A 7: 6,068,708 (GRCm39) L203* probably null Het
Nos1 T A 5: 118,085,496 (GRCm39) C1275S probably damaging Het
Or14a256 T C 7: 86,264,900 (GRCm39) S318G probably null Het
Or4a69 A G 2: 89,313,458 (GRCm39) V7A possibly damaging Het
Or5an9 T C 19: 12,187,242 (GRCm39) I104T possibly damaging Het
Or5d39 T C 2: 87,979,716 (GRCm39) T216A possibly damaging Het
Or5j3 T A 2: 86,128,564 (GRCm39) S135T probably benign Het
Or8b12b A T 9: 37,684,437 (GRCm39) N161Y possibly damaging Het
Pip4k2b T C 11: 97,623,542 (GRCm39) M67V possibly damaging Het
Polq C A 16: 36,909,715 (GRCm39) Y2366* probably null Het
Prg3 T C 2: 84,819,097 (GRCm39) S8P probably benign Het
Prl7c1 A T 13: 27,962,952 (GRCm39) L17* probably null Het
Prl8a8 A T 13: 27,695,479 (GRCm39) S51R probably damaging Het
Pttg1 G C 11: 43,311,976 (GRCm39) P160A probably benign Het
Rbfox1 C A 16: 7,170,867 (GRCm39) R276S possibly damaging Het
Rnase2a T G 14: 51,492,988 (GRCm39) M126L probably benign Het
Secisbp2 A T 13: 51,810,943 (GRCm39) K202* probably null Het
Sema6c A G 3: 95,076,156 (GRCm39) H236R possibly damaging Het
Septin12 A G 16: 4,809,857 (GRCm39) L181P probably damaging Het
Shc3 A T 13: 51,585,241 (GRCm39) V458D possibly damaging Het
Tecta A G 9: 42,278,239 (GRCm39) Y1090H probably benign Het
Thsd7a A T 6: 12,379,429 (GRCm39) N998K Het
Tmem131l A T 3: 83,826,766 (GRCm39) S1184T possibly damaging Het
Tnfsf15 T C 4: 63,647,887 (GRCm39) D251G probably damaging Het
Ttyh3 T C 5: 140,615,540 (GRCm39) E348G probably benign Het
Unc5c T C 3: 141,439,665 (GRCm39) L186P probably damaging Het
Vmn2r37 A T 7: 9,219,045 (GRCm39) N446K probably damaging Het
Vmn2r63 T C 7: 42,577,959 (GRCm39) D193G possibly damaging Het
Vmn2r85 A T 10: 130,262,376 (GRCm39) M121K probably benign Het
Vmn2r88 A G 14: 51,651,253 (GRCm39) D189G Het
Vwc2l C A 1: 70,768,252 (GRCm39) C105* probably null Het
Wdr72 T A 9: 74,055,597 (GRCm39) D275E probably damaging Het
Zfhx4 A T 3: 5,467,549 (GRCm39) D2594V probably damaging Het
Zfp174 C T 16: 3,672,269 (GRCm39) H273Y probably benign Het
Zwilch A G 9: 64,068,658 (GRCm39) S203P probably damaging Het
Other mutations in Esyt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02576:Esyt3 APN 9 99,197,278 (GRCm39) missense probably benign 0.07
IGL02596:Esyt3 APN 9 99,210,068 (GRCm39) missense probably benign 0.02
IGL02716:Esyt3 APN 9 99,199,277 (GRCm39) missense probably damaging 1.00
IGL02836:Esyt3 APN 9 99,202,960 (GRCm39) splice site probably benign
IGL03372:Esyt3 APN 9 99,218,109 (GRCm39) splice site probably benign
R0008:Esyt3 UTSW 9 99,220,860 (GRCm39) missense possibly damaging 0.89
R1217:Esyt3 UTSW 9 99,200,097 (GRCm39) missense possibly damaging 0.92
R1395:Esyt3 UTSW 9 99,198,835 (GRCm39) unclassified probably benign
R1478:Esyt3 UTSW 9 99,200,119 (GRCm39) missense probably benign 0.03
R1710:Esyt3 UTSW 9 99,218,244 (GRCm39) missense probably benign
R1792:Esyt3 UTSW 9 99,240,169 (GRCm39) nonsense probably null
R1913:Esyt3 UTSW 9 99,202,364 (GRCm39) missense probably benign 0.00
R3792:Esyt3 UTSW 9 99,197,334 (GRCm39) missense possibly damaging 0.93
R3793:Esyt3 UTSW 9 99,197,334 (GRCm39) missense possibly damaging 0.93
R3937:Esyt3 UTSW 9 99,218,245 (GRCm39) missense probably benign
R3964:Esyt3 UTSW 9 99,202,375 (GRCm39) missense probably damaging 1.00
R3965:Esyt3 UTSW 9 99,202,375 (GRCm39) missense probably damaging 1.00
R4061:Esyt3 UTSW 9 99,202,891 (GRCm39) missense probably damaging 1.00
R4088:Esyt3 UTSW 9 99,206,290 (GRCm39) missense probably benign
R4436:Esyt3 UTSW 9 99,240,078 (GRCm39) intron probably benign
R5274:Esyt3 UTSW 9 99,200,350 (GRCm39) missense probably benign
R5590:Esyt3 UTSW 9 99,240,466 (GRCm39) utr 5 prime probably benign
R5705:Esyt3 UTSW 9 99,200,260 (GRCm39) missense probably benign 0.00
R6543:Esyt3 UTSW 9 99,220,825 (GRCm39) missense possibly damaging 0.77
R6738:Esyt3 UTSW 9 99,202,346 (GRCm39) missense probably damaging 0.98
R7000:Esyt3 UTSW 9 99,204,206 (GRCm39) missense probably damaging 0.99
R7019:Esyt3 UTSW 9 99,197,338 (GRCm39) missense probably benign 0.11
R7130:Esyt3 UTSW 9 99,200,223 (GRCm39) missense probably benign
R7141:Esyt3 UTSW 9 99,203,493 (GRCm39) missense probably benign 0.12
R7145:Esyt3 UTSW 9 99,201,627 (GRCm39) missense probably damaging 1.00
R7447:Esyt3 UTSW 9 99,203,615 (GRCm39) missense probably damaging 1.00
R7459:Esyt3 UTSW 9 99,240,117 (GRCm39) missense probably benign 0.00
R7767:Esyt3 UTSW 9 99,207,024 (GRCm39) missense probably benign 0.00
R8397:Esyt3 UTSW 9 99,209,966 (GRCm39) missense probably benign 0.01
R8560:Esyt3 UTSW 9 99,202,375 (GRCm39) missense probably damaging 1.00
R8882:Esyt3 UTSW 9 99,202,909 (GRCm39) missense probably damaging 0.99
R9320:Esyt3 UTSW 9 99,194,044 (GRCm39) missense probably damaging 1.00
R9537:Esyt3 UTSW 9 99,199,292 (GRCm39) missense probably damaging 0.98
R9786:Esyt3 UTSW 9 99,194,038 (GRCm39) missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- CATCCCTTACAGGAGAAGTACTGTC -3'
(R):5'- ATACTGATGGCACCCGTGTG -3'

Sequencing Primer
(F):5'- CCTTACAGGAGAAGTACTGTCTGAGG -3'
(R):5'- CGTGTGACCTCTGCAGAG -3'
Posted On 2019-05-15