Incidental Mutation 'R7104:Vmn2r88'
ID551075
Institutional Source Beutler Lab
Gene Symbol Vmn2r88
Ensembl Gene ENSMUSG00000000606
Gene Namevomeronasal 2, receptor 88
SynonymsV2r3, V2r13
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R7104 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location51410819-51419527 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51413796 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 189 (D189G)
Ref Sequence ENSEMBL: ENSMUSP00000125126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022438] [ENSMUST00000159674] [ENSMUST00000162998] [ENSMUST00000228139]
Predicted Effect probably damaging
Transcript: ENSMUST00000022438
AA Change: D197G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000022438
Gene: ENSMUSG00000000606
AA Change: D197G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ANF_receptor 76 457 8.3e-27 PFAM
Pfam:NCD3G 516 570 1.2e-18 PFAM
Pfam:7tm_3 603 838 1.9e-55 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000125126
Gene: ENSMUSG00000000606
AA Change: D189G

DomainStartEndE-ValueType
Pfam:ANF_receptor 30 408 3.2e-30 PFAM
Pfam:NCD3G 463 516 1.2e-19 PFAM
Pfam:7tm_3 546 785 3.7e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162998
SMART Domains Protein: ENSMUSP00000125409
Gene: ENSMUSG00000068399

DomainStartEndE-ValueType
Pfam:Takusan 35 115 2.2e-25 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000124837
Gene: ENSMUSG00000000606
AA Change: D164G

DomainStartEndE-ValueType
Pfam:ANF_receptor 52 399 3.7e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000228139
AA Change: D189G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,194,444 L897P possibly damaging Het
Agbl2 A G 2: 90,797,547 E232G probably damaging Het
Atf7 A G 15: 102,534,235 S480P probably benign Het
Cdk14 A G 5: 5,195,325 I166T possibly damaging Het
Cdk5rap2 G T 4: 70,349,156 F358L probably benign Het
Cytip A G 2: 58,159,974 S28P probably benign Het
Dennd5b C T 6: 149,044,604 R503Q probably damaging Het
Dnajc10 T A 2: 80,340,815 C480S probably damaging Het
Drc7 A G 8: 95,059,083 D189G probably damaging Het
Engase G A 11: 118,481,295 V138M probably damaging Het
Esyt3 C A 9: 99,338,787 R121L probably damaging Het
Frem1 T G 4: 82,940,681 I1516L probably benign Het
Gatad2b T A 3: 90,351,417 I249N probably damaging Het
Grk6 T C 13: 55,454,406 S383P probably benign Het
Hectd1 C T 12: 51,827,351 probably null Het
Hipk2 A G 6: 38,818,644 L230P probably damaging Het
Hivep1 A T 13: 42,157,338 Q1018L probably benign Het
Itgad T C 7: 128,198,378 F927S probably benign Het
Itgb3bp A G 4: 99,814,098 V3A probably damaging Het
Kcnh7 G T 2: 62,787,687 A486D possibly damaging Het
Krt2 T C 15: 101,815,087 T318A probably benign Het
Ndrg1 A G 15: 66,946,528 F77S probably damaging Het
Nlrp4c T A 7: 6,065,709 L203* probably null Het
Nos1 T A 5: 117,947,431 C1275S probably damaging Het
Olfr1052 T A 2: 86,298,220 S135T probably benign Het
Olfr1167 T C 2: 88,149,372 T216A possibly damaging Het
Olfr1241 A G 2: 89,483,114 V7A possibly damaging Het
Olfr1431 T C 19: 12,209,878 I104T possibly damaging Het
Olfr294 T C 7: 86,615,692 S318G probably null Het
Olfr875 A T 9: 37,773,141 N161Y possibly damaging Het
Pip4k2b T C 11: 97,732,716 M67V possibly damaging Het
Polq C A 16: 37,089,353 Y2366* probably null Het
Prg3 T C 2: 84,988,753 S8P probably benign Het
Prl7c1 A T 13: 27,778,969 L17* probably null Het
Prl8a8 A T 13: 27,511,496 S51R probably damaging Het
Pttg1 G C 11: 43,421,149 P160A probably benign Het
Rbfox1 C A 16: 7,353,003 R276S possibly damaging Het
Rnase2a T G 14: 51,255,531 M126L probably benign Het
Secisbp2 A T 13: 51,656,907 K202* probably null Het
Sema6c A G 3: 95,168,845 H236R possibly damaging Het
Sept12 A G 16: 4,991,993 L181P probably damaging Het
Shc3 A T 13: 51,431,205 V458D possibly damaging Het
Tecta A G 9: 42,366,943 Y1090H probably benign Het
Thsd7a A T 6: 12,379,430 N998K Het
Tmem131l A T 3: 83,919,459 S1184T possibly damaging Het
Tnfsf15 T C 4: 63,729,650 D251G probably damaging Het
Ttyh3 T C 5: 140,629,785 E348G probably benign Het
Unc5c T C 3: 141,733,904 L186P probably damaging Het
Vmn2r37 A T 7: 9,216,046 N446K probably damaging Het
Vmn2r63 T C 7: 42,928,535 D193G possibly damaging Het
Vmn2r85 A T 10: 130,426,507 M121K probably benign Het
Vwc2l C A 1: 70,729,093 C105* probably null Het
Wdr72 T A 9: 74,148,315 D275E probably damaging Het
Zfhx4 A T 3: 5,402,489 D2594V probably damaging Het
Zfp174 C T 16: 3,854,405 H273Y probably benign Het
Zwilch A G 9: 64,161,376 S203P probably damaging Het
Other mutations in Vmn2r88
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Vmn2r88 APN 14 51413125 missense probably benign 0.00
IGL00990:Vmn2r88 APN 14 51413060 missense probably benign 0.00
IGL00990:Vmn2r88 APN 14 51413256 missense probably benign 0.00
IGL00990:Vmn2r88 APN 14 51416802 missense possibly damaging 0.59
IGL02308:Vmn2r88 APN 14 51417980 missense possibly damaging 0.96
IGL02481:Vmn2r88 APN 14 51414154 missense probably benign
IGL02483:Vmn2r88 APN 14 51414154 missense probably benign
IGL03241:Vmn2r88 APN 14 51418373 missense probably benign 0.03
R0052:Vmn2r88 UTSW 14 51418700 missense possibly damaging 0.88
R0070:Vmn2r88 UTSW 14 51414140 missense probably benign 0.08
R0799:Vmn2r88 UTSW 14 51414502 missense possibly damaging 0.61
R0906:Vmn2r88 UTSW 14 51418209 missense probably damaging 1.00
R1322:Vmn2r88 UTSW 14 51414108 missense probably damaging 1.00
R1352:Vmn2r88 UTSW 14 51418550 missense probably damaging 1.00
R1639:Vmn2r88 UTSW 14 51416787 missense probably damaging 0.98
R1780:Vmn2r88 UTSW 14 51418572 missense probably damaging 1.00
R1834:Vmn2r88 UTSW 14 51413030 splice site probably benign
R1911:Vmn2r88 UTSW 14 51418214 missense probably damaging 1.00
R2113:Vmn2r88 UTSW 14 51418194 missense probably damaging 1.00
R2120:Vmn2r88 UTSW 14 51413208 missense probably benign 0.00
R2126:Vmn2r88 UTSW 14 51413807 missense probably benign 0.01
R2348:Vmn2r88 UTSW 14 51414004 missense probably benign 0.00
R2881:Vmn2r88 UTSW 14 51418689 missense probably damaging 0.97
R2884:Vmn2r88 UTSW 14 51413934 missense probably damaging 1.00
R3081:Vmn2r88 UTSW 14 51418632 missense probably damaging 0.99
R3933:Vmn2r88 UTSW 14 51413978 missense probably benign 0.44
R3967:Vmn2r88 UTSW 14 51413190 missense probably benign 0.06
R4091:Vmn2r88 UTSW 14 51415426 missense probably damaging 1.00
R4378:Vmn2r88 UTSW 14 51413289 nonsense probably null
R4397:Vmn2r88 UTSW 14 51417978 missense probably damaging 1.00
R4418:Vmn2r88 UTSW 14 51418081 missense probably damaging 1.00
R4609:Vmn2r88 UTSW 14 51418074 missense probably damaging 0.98
R4647:Vmn2r88 UTSW 14 51418793 missense probably benign 0.02
R4672:Vmn2r88 UTSW 14 51418155 missense probably damaging 1.00
R4684:Vmn2r88 UTSW 14 51413334 missense possibly damaging 0.95
R4686:Vmn2r88 UTSW 14 51413339 missense probably benign 0.03
R4720:Vmn2r88 UTSW 14 51413245 missense probably benign 0.01
R5046:Vmn2r88 UTSW 14 51413181 missense probably benign 0.03
R5063:Vmn2r88 UTSW 14 51411146 missense probably damaging 0.96
R5619:Vmn2r88 UTSW 14 51413910 missense probably damaging 0.99
R5652:Vmn2r88 UTSW 14 51418572 missense probably damaging 0.98
R6020:Vmn2r88 UTSW 14 51418149 nonsense probably null
R6103:Vmn2r88 UTSW 14 51415369 missense probably benign 0.17
R6674:Vmn2r88 UTSW 14 51414338 missense probably benign 0.01
R6799:Vmn2r88 UTSW 14 51413969 missense probably benign 0.05
R7089:Vmn2r88 UTSW 14 51418643 missense
R7265:Vmn2r88 UTSW 14 51418319 missense
R7316:Vmn2r88 UTSW 14 51414255 missense
R7552:Vmn2r88 UTSW 14 51410858 splice site probably null
R7611:Vmn2r88 UTSW 14 51413997 missense
R7667:Vmn2r88 UTSW 14 51417989 missense
R7682:Vmn2r88 UTSW 14 51418449 missense
R7755:Vmn2r88 UTSW 14 51413046 missense probably benign 0.00
R7811:Vmn2r88 UTSW 14 51418703 missense
R7882:Vmn2r88 UTSW 14 51413046 missense probably benign 0.00
R7957:Vmn2r88 UTSW 14 51413132 missense
R7998:Vmn2r88 UTSW 14 51414108 missense
R8142:Vmn2r88 UTSW 14 51414107 missense
R8186:Vmn2r88 UTSW 14 51418700 missense
R8348:Vmn2r88 UTSW 14 51418796 missense probably damaging 0.97
R8448:Vmn2r88 UTSW 14 51418796 missense probably damaging 0.97
R8483:Vmn2r88 UTSW 14 51413073 missense possibly damaging 0.48
R8783:Vmn2r88 UTSW 14 51414066 missense
R8859:Vmn2r88 UTSW 14 51418806 missense probably damaging 0.97
R8916:Vmn2r88 UTSW 14 51411136 missense
R8936:Vmn2r88 UTSW 14 51418526 missense possibly damaging 0.88
V5622:Vmn2r88 UTSW 14 51413127 missense probably benign
X0024:Vmn2r88 UTSW 14 51413832 missense possibly damaging 0.79
X0025:Vmn2r88 UTSW 14 51416802 missense possibly damaging 0.59
Z1177:Vmn2r88 UTSW 14 51418046 frame shift probably null
Z1177:Vmn2r88 UTSW 14 51418187 missense
Z1190:Vmn2r88 UTSW 14 51413201 missense
Predicted Primers PCR Primer
(F):5'- GGAAGGTGAGTAGCATTACCTG -3'
(R):5'- CTTCTAGTGTAGAGTTCATTTCACC -3'

Sequencing Primer
(F):5'- GCATTACCTGTATATGAGTCCGAGC -3'
(R):5'- AGCCCTTGTCATGTATATCTGCATG -3'
Posted On2019-05-15