Mutagenetix > Incidental Mutation

Incidental Mutation 'R7104:Vmn2r88'

551075

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r88

Ensembl Gene

ENSMUSG00000000606

Gene Name

vomeronasal 2, receptor 88

Synonyms

V2r3, V2r13

MMRRC Submission

045196-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.121) question?

Stock #

R7104 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

51410819-51419527 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 51413796 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 189 (D189G)

Ref Sequence

ENSEMBL: ENSMUSP00000125126 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022438] [ENSMUST00000159674] [ENSMUST00000162998] [ENSMUST00000228139]

AlphaFold

L7N1W8

Predicted Effect

probably damaging
Transcript: ENSMUST00000022438
AA Change: D197G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000022438
Gene: ENSMUSG00000000606
AA Change: D197G

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:ANF_receptor	76	457	8.3e-27	PFAM
Pfam:NCD3G	516	570	1.2e-18	PFAM
Pfam:7tm_3	603	838	1.9e-55	PFAM

Predicted Effect

SMART Domains

Protein: ENSMUSP00000125126
Gene: ENSMUSG00000000606
AA Change: D189G

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	30	408	3.2e-30	PFAM
Pfam:NCD3G	463	516	1.2e-19	PFAM
Pfam:7tm_3	546	785	3.7e-81	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000162998

SMART Domains

Protein: ENSMUSP00000125409
Gene: ENSMUSG00000068399

Domain	Start	End	E-Value	Type
Pfam:Takusan	35	115	2.2e-25	PFAM

Predicted Effect

SMART Domains

Protein: ENSMUSP00000124837
Gene: ENSMUSG00000000606
AA Change: D164G

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	52	399	3.7e-30	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000228139
AA Change: D189G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	C	15: 8,194,444	L897P	possibly damaging	Het
Agbl2	A	G	2: 90,797,547	E232G	probably damaging	Het
Atf7	A	G	15: 102,534,235	S480P	probably benign	Het
Cdk14	A	G	5: 5,195,325	I166T	possibly damaging	Het
Cdk5rap2	G	T	4: 70,349,156	F358L	probably benign	Het
Cytip	A	G	2: 58,159,974	S28P	probably benign	Het
Dennd5b	C	T	6: 149,044,604	R503Q	probably damaging	Het
Dnajc10	T	A	2: 80,340,815	C480S	probably damaging	Het
Drc7	A	G	8: 95,059,083	D189G	probably damaging	Het
Engase	G	A	11: 118,481,295	V138M	probably damaging	Het
Esyt3	C	A	9: 99,338,787	R121L	probably damaging	Het
Frem1	T	G	4: 82,940,681	I1516L	probably benign	Het
Gatad2b	T	A	3: 90,351,417	I249N	probably damaging	Het
Grk6	T	C	13: 55,454,406	S383P	probably benign	Het
Hectd1	C	T	12: 51,827,351		probably null	Het
Hipk2	A	G	6: 38,818,644	L230P	probably damaging	Het
Hivep1	A	T	13: 42,157,338	Q1018L	probably benign	Het
Itgad	T	C	7: 128,198,378	F927S	probably benign	Het
Itgb3bp	A	G	4: 99,814,098	V3A	probably damaging	Het
Kcnh7	G	T	2: 62,787,687	A486D	possibly damaging	Het
Krt2	T	C	15: 101,815,087	T318A	probably benign	Het
Ndrg1	A	G	15: 66,946,528	F77S	probably damaging	Het
Nlrp4c	T	A	7: 6,065,709	L203*	probably null	Het
Nos1	T	A	5: 117,947,431	C1275S	probably damaging	Het
Olfr1052	T	A	2: 86,298,220	S135T	probably benign	Het
Olfr1167	T	C	2: 88,149,372	T216A	possibly damaging	Het
Olfr1241	A	G	2: 89,483,114	V7A	possibly damaging	Het
Olfr1431	T	C	19: 12,209,878	I104T	possibly damaging	Het
Olfr294	T	C	7: 86,615,692	S318G	probably null	Het
Olfr875	A	T	9: 37,773,141	N161Y	possibly damaging	Het
Pip4k2b	T	C	11: 97,732,716	M67V	possibly damaging	Het
Polq	C	A	16: 37,089,353	Y2366*	probably null	Het
Prg3	T	C	2: 84,988,753	S8P	probably benign	Het
Prl7c1	A	T	13: 27,778,969	L17*	probably null	Het
Prl8a8	A	T	13: 27,511,496	S51R	probably damaging	Het
Pttg1	G	C	11: 43,421,149	P160A	probably benign	Het
Rbfox1	C	A	16: 7,353,003	R276S	possibly damaging	Het
Rnase2a	T	G	14: 51,255,531	M126L	probably benign	Het
Secisbp2	A	T	13: 51,656,907	K202*	probably null	Het
Sema6c	A	G	3: 95,168,845	H236R	possibly damaging	Het
Sept12	A	G	16: 4,991,993	L181P	probably damaging	Het
Shc3	A	T	13: 51,431,205	V458D	possibly damaging	Het
Tecta	A	G	9: 42,366,943	Y1090H	probably benign	Het
Thsd7a	A	T	6: 12,379,430	N998K		Het
Tmem131l	A	T	3: 83,919,459	S1184T	possibly damaging	Het
Tnfsf15	T	C	4: 63,729,650	D251G	probably damaging	Het
Ttyh3	T	C	5: 140,629,785	E348G	probably benign	Het
Unc5c	T	C	3: 141,733,904	L186P	probably damaging	Het
Vmn2r37	A	T	7: 9,216,046	N446K	probably damaging	Het
Vmn2r63	T	C	7: 42,928,535	D193G	possibly damaging	Het
Vmn2r85	A	T	10: 130,426,507	M121K	probably benign	Het
Vwc2l	C	A	1: 70,729,093	C105*	probably null	Het
Wdr72	T	A	9: 74,148,315	D275E	probably damaging	Het
Zfhx4	A	T	3: 5,402,489	D2594V	probably damaging	Het
Zfp174	C	T	16: 3,854,405	H273Y	probably benign	Het
Zwilch	A	G	9: 64,161,376	S203P	probably damaging	Het

Other mutations in Vmn2r88

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00990:Vmn2r88	APN	14	51413125	missense	probably benign	0.00
IGL00990:Vmn2r88	APN	14	51413060	missense	probably benign	0.00
IGL00990:Vmn2r88	APN	14	51413256	missense	probably benign	0.00
IGL00990:Vmn2r88	APN	14	51416802	missense	possibly damaging	0.59
IGL02308:Vmn2r88	APN	14	51417980	missense	possibly damaging	0.96
IGL02481:Vmn2r88	APN	14	51414154	missense	probably benign
IGL02483:Vmn2r88	APN	14	51414154	missense	probably benign
IGL03241:Vmn2r88	APN	14	51418373	missense	probably benign	0.03
R0052:Vmn2r88	UTSW	14	51418700	missense	possibly damaging	0.88
R0070:Vmn2r88	UTSW	14	51414140	missense	probably benign	0.08
R0799:Vmn2r88	UTSW	14	51414502	missense	possibly damaging	0.61
R0906:Vmn2r88	UTSW	14	51418209	missense	probably damaging	1.00
R1322:Vmn2r88	UTSW	14	51414108	missense	probably damaging	1.00
R1352:Vmn2r88	UTSW	14	51418550	missense	probably damaging	1.00
R1639:Vmn2r88	UTSW	14	51416787	missense	probably damaging	0.98
R1780:Vmn2r88	UTSW	14	51418572	missense	probably damaging	1.00
R1834:Vmn2r88	UTSW	14	51413030	splice site	probably benign
R1911:Vmn2r88	UTSW	14	51418214	missense	probably damaging	1.00
R2113:Vmn2r88	UTSW	14	51418194	missense	probably damaging	1.00
R2120:Vmn2r88	UTSW	14	51413208	missense	probably benign	0.00
R2126:Vmn2r88	UTSW	14	51413807	missense	probably benign	0.01
R2348:Vmn2r88	UTSW	14	51414004	missense	probably benign	0.00
R2881:Vmn2r88	UTSW	14	51418689	missense	probably damaging	0.97
R2884:Vmn2r88	UTSW	14	51413934	missense	probably damaging	1.00
R3081:Vmn2r88	UTSW	14	51418632	missense	probably damaging	0.99
R3933:Vmn2r88	UTSW	14	51413978	missense	probably benign	0.44
R3967:Vmn2r88	UTSW	14	51413190	missense	probably benign	0.06
R4091:Vmn2r88	UTSW	14	51415426	missense	probably damaging	1.00
R4378:Vmn2r88	UTSW	14	51413289	nonsense	probably null
R4397:Vmn2r88	UTSW	14	51417978	missense	probably damaging	1.00
R4418:Vmn2r88	UTSW	14	51418081	missense	probably damaging	1.00
R4609:Vmn2r88	UTSW	14	51418074	missense	probably damaging	0.98
R4647:Vmn2r88	UTSW	14	51418793	missense	probably benign	0.02
R4672:Vmn2r88	UTSW	14	51418155	missense	probably damaging	1.00
R4684:Vmn2r88	UTSW	14	51413334	missense	possibly damaging	0.95
R4686:Vmn2r88	UTSW	14	51413339	missense	probably benign	0.03
R4720:Vmn2r88	UTSW	14	51413245	missense	probably benign	0.01
R5046:Vmn2r88	UTSW	14	51413181	missense	probably benign	0.03
R5063:Vmn2r88	UTSW	14	51411146	missense	probably damaging	0.96
R5619:Vmn2r88	UTSW	14	51413910	missense	probably damaging	0.99
R5652:Vmn2r88	UTSW	14	51418572	missense	probably damaging	0.98
R6020:Vmn2r88	UTSW	14	51418149	nonsense	probably null
R6103:Vmn2r88	UTSW	14	51415369	missense	probably benign	0.17
R6674:Vmn2r88	UTSW	14	51414338	missense	probably benign	0.01
R6799:Vmn2r88	UTSW	14	51413969	missense	probably benign	0.05
R7089:Vmn2r88	UTSW	14	51418643	missense
R7265:Vmn2r88	UTSW	14	51418319	missense
R7316:Vmn2r88	UTSW	14	51414255	missense
R7552:Vmn2r88	UTSW	14	51410858	splice site	probably null
R7611:Vmn2r88	UTSW	14	51413997	missense
R7667:Vmn2r88	UTSW	14	51417989	missense
R7682:Vmn2r88	UTSW	14	51418449	missense
R7755:Vmn2r88	UTSW	14	51413046	missense	probably benign	0.00
R7811:Vmn2r88	UTSW	14	51418703	missense
R7882:Vmn2r88	UTSW	14	51413046	missense	probably benign	0.00
R7957:Vmn2r88	UTSW	14	51413132	missense
R7998:Vmn2r88	UTSW	14	51414108	missense
R8142:Vmn2r88	UTSW	14	51414107	missense
R8186:Vmn2r88	UTSW	14	51418700	missense
R8348:Vmn2r88	UTSW	14	51418796	missense	probably damaging	0.97
R8448:Vmn2r88	UTSW	14	51418796	missense	probably damaging	0.97
R8483:Vmn2r88	UTSW	14	51413073	missense	possibly damaging	0.48
R8783:Vmn2r88	UTSW	14	51414066	missense
R8859:Vmn2r88	UTSW	14	51418806	missense	probably damaging	0.97
R8916:Vmn2r88	UTSW	14	51411136	missense
R8936:Vmn2r88	UTSW	14	51418526	missense	possibly damaging	0.88
R9004:Vmn2r88	UTSW	14	51413167	missense
R9038:Vmn2r88	UTSW	14	51414033	missense
R9063:Vmn2r88	UTSW	14	51410872	start gained	probably benign
R9311:Vmn2r88	UTSW	14	51413046	missense	probably benign	0.00
R9382:Vmn2r88	UTSW	14	51418740	missense
R9483:Vmn2r88	UTSW	14	51411184	missense
R9602:Vmn2r88	UTSW	14	51413732	missense
V5622:Vmn2r88	UTSW	14	51413127	missense	probably benign
X0024:Vmn2r88	UTSW	14	51413832	missense	possibly damaging	0.79
X0025:Vmn2r88	UTSW	14	51416802	missense	possibly damaging	0.59
Z1177:Vmn2r88	UTSW	14	51418046	frame shift	probably null
Z1177:Vmn2r88	UTSW	14	51418187	missense
Z1190:Vmn2r88	UTSW	14	51413201	missense

Predicted Primers

PCR Primer
(F):5'- GGAAGGTGAGTAGCATTACCTG -3'
(R):5'- CTTCTAGTGTAGAGTTCATTTCACC -3'

Sequencing Primer
(F):5'- GCATTACCTGTATATGAGTCCGAGC -3'
(R):5'- AGCCCTTGTCATGTATATCTGCATG -3'

Posted On

2019-05-15