Mutagenetix > Incidental Mutation

Incidental Mutation 'R7104:Krt2'

551078

Institutional Source

Beutler Lab

Gene Symbol

Krt2

Ensembl Gene

ENSMUSG00000064201

Gene Name

keratin 2

Synonyms

Krt2-17, Krt2-2, Krt2e

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.131) question?

Stock #

R7104 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

101810689-101818169 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 101815087 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 318 (T318A)

Ref Sequence

ENSEMBL: ENSMUSP00000023712 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023712]

AlphaFold

Q3TTY5

Predicted Effect

probably benign
Transcript: ENSMUST00000023712
AA Change: T318A

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000023712
Gene: ENSMUSG00000064201
AA Change: T318A

Domain	Start	End	E-Value	Type
Pfam:Keratin_2_head	23	195	3.6e-26	PFAM
Filament	198	511	4.22e-152	SMART
low complexity region	520	533	N/A	INTRINSIC
low complexity region	538	701	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

PHENOTYPE: ENU-induced mutant mice exhibit scaly skin and increased pigmentation in the tail, ears and feet. Mice homozygous for a knock-out allele show scaly skin, acanthosis, hyperkeratosis, increased water loss, ear skin inflammation, and aberrant aggregation of keratin 10 in suprabasal epidermal keratinocytes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	C	15: 8,194,444	L897P	possibly damaging	Het
Agbl2	A	G	2: 90,797,547	E232G	probably damaging	Het
Atf7	A	G	15: 102,534,235	S480P	probably benign	Het
Cdk14	A	G	5: 5,195,325	I166T	possibly damaging	Het
Cdk5rap2	G	T	4: 70,349,156	F358L	probably benign	Het
Cytip	A	G	2: 58,159,974	S28P	probably benign	Het
Dennd5b	C	T	6: 149,044,604	R503Q	probably damaging	Het
Dnajc10	T	A	2: 80,340,815	C480S	probably damaging	Het
Drc7	A	G	8: 95,059,083	D189G	probably damaging	Het
Engase	G	A	11: 118,481,295	V138M	probably damaging	Het
Esyt3	C	A	9: 99,338,787	R121L	probably damaging	Het
Frem1	T	G	4: 82,940,681	I1516L	probably benign	Het
Gatad2b	T	A	3: 90,351,417	I249N	probably damaging	Het
Grk6	T	C	13: 55,454,406	S383P	probably benign	Het
Hectd1	C	T	12: 51,827,351		probably null	Het
Hipk2	A	G	6: 38,818,644	L230P	probably damaging	Het
Hivep1	A	T	13: 42,157,338	Q1018L	probably benign	Het
Itgad	T	C	7: 128,198,378	F927S	probably benign	Het
Itgb3bp	A	G	4: 99,814,098	V3A	probably damaging	Het
Kcnh7	G	T	2: 62,787,687	A486D	possibly damaging	Het
Ndrg1	A	G	15: 66,946,528	F77S	probably damaging	Het
Nlrp4c	T	A	7: 6,065,709	L203*	probably null	Het
Nos1	T	A	5: 117,947,431	C1275S	probably damaging	Het
Olfr1052	T	A	2: 86,298,220	S135T	probably benign	Het
Olfr1167	T	C	2: 88,149,372	T216A	possibly damaging	Het
Olfr1241	A	G	2: 89,483,114	V7A	possibly damaging	Het
Olfr1431	T	C	19: 12,209,878	I104T	possibly damaging	Het
Olfr294	T	C	7: 86,615,692	S318G	probably null	Het
Olfr875	A	T	9: 37,773,141	N161Y	possibly damaging	Het
Pip4k2b	T	C	11: 97,732,716	M67V	possibly damaging	Het
Polq	C	A	16: 37,089,353	Y2366*	probably null	Het
Prg3	T	C	2: 84,988,753	S8P	probably benign	Het
Prl7c1	A	T	13: 27,778,969	L17*	probably null	Het
Prl8a8	A	T	13: 27,511,496	S51R	probably damaging	Het
Pttg1	G	C	11: 43,421,149	P160A	probably benign	Het
Rbfox1	C	A	16: 7,353,003	R276S	possibly damaging	Het
Rnase2a	T	G	14: 51,255,531	M126L	probably benign	Het
Secisbp2	A	T	13: 51,656,907	K202*	probably null	Het
Sema6c	A	G	3: 95,168,845	H236R	possibly damaging	Het
Sept12	A	G	16: 4,991,993	L181P	probably damaging	Het
Shc3	A	T	13: 51,431,205	V458D	possibly damaging	Het
Tecta	A	G	9: 42,366,943	Y1090H	probably benign	Het
Thsd7a	A	T	6: 12,379,430	N998K		Het
Tmem131l	A	T	3: 83,919,459	S1184T	possibly damaging	Het
Tnfsf15	T	C	4: 63,729,650	D251G	probably damaging	Het
Ttyh3	T	C	5: 140,629,785	E348G	probably benign	Het
Unc5c	T	C	3: 141,733,904	L186P	probably damaging	Het
Vmn2r37	A	T	7: 9,216,046	N446K	probably damaging	Het
Vmn2r63	T	C	7: 42,928,535	D193G	possibly damaging	Het
Vmn2r85	A	T	10: 130,426,507	M121K	probably benign	Het
Vmn2r88	A	G	14: 51,413,796	D189G		Het
Vwc2l	C	A	1: 70,729,093	C105*	probably null	Het
Wdr72	T	A	9: 74,148,315	D275E	probably damaging	Het
Zfhx4	A	T	3: 5,402,489	D2594V	probably damaging	Het
Zfp174	C	T	16: 3,854,405	H273Y	probably benign	Het
Zwilch	A	G	9: 64,161,376	S203P	probably damaging	Het

Other mutations in Krt2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01316:Krt2	APN	15	101811211	missense	probably benign	0.23
IGL01568:Krt2	APN	15	101813211	missense	probably damaging	1.00
IGL01586:Krt2	APN	15	101811390	missense	unknown
IGL01667:Krt2	APN	15	101816330	missense	possibly damaging	0.85
IGL02017:Krt2	APN	15	101816504	missense	probably damaging	1.00
IGL02022:Krt2	APN	15	101816518	missense	probably damaging	1.00
IGL02538:Krt2	APN	15	101811154	missense	unknown
IGL02959:Krt2	APN	15	101811328	missense	unknown
IGL03295:Krt2	APN	15	101816429	missense	probably damaging	0.99
R0195:Krt2	UTSW	15	101813191	nonsense	probably null
R0472:Krt2	UTSW	15	101813253	missense	probably damaging	1.00
R0749:Krt2	UTSW	15	101817663	missense	unknown
R0785:Krt2	UTSW	15	101817921	missense	unknown
R0792:Krt2	UTSW	15	101816497	missense	probably damaging	1.00
R1232:Krt2	UTSW	15	101811784	missense	probably damaging	1.00
R1281:Krt2	UTSW	15	101813292	missense	probably damaging	1.00
R1770:Krt2	UTSW	15	101811154	missense	unknown
R1783:Krt2	UTSW	15	101813973	missense	probably damaging	1.00
R1795:Krt2	UTSW	15	101816426	missense	possibly damaging	0.85
R2283:Krt2	UTSW	15	101814387	missense	probably damaging	1.00
R3977:Krt2	UTSW	15	101811127	missense	unknown
R4575:Krt2	UTSW	15	101814486	missense	probably damaging	1.00
R4619:Krt2	UTSW	15	101817591	missense	probably damaging	1.00
R4620:Krt2	UTSW	15	101817591	missense	probably damaging	1.00
R4766:Krt2	UTSW	15	101813960	missense	probably damaging	1.00
R4819:Krt2	UTSW	15	101811544	missense	unknown
R4953:Krt2	UTSW	15	101813942	missense	probably damaging	1.00
R5108:Krt2	UTSW	15	101813286	missense	possibly damaging	0.88
R5973:Krt2	UTSW	15	101816312	missense	probably damaging	0.99
R6122:Krt2	UTSW	15	101815914	missense	probably damaging	1.00
R6180:Krt2	UTSW	15	101815044	missense	probably benign	0.05
R6661:Krt2	UTSW	15	101815963	missense	probably damaging	1.00
R6974:Krt2	UTSW	15	101817879	missense	unknown
R6993:Krt2	UTSW	15	101815960	missense	probably damaging	1.00
R7573:Krt2	UTSW	15	101814519	missense	probably benign	0.05
R7947:Krt2	UTSW	15	101816334	missense	probably damaging	1.00
R8469:Krt2	UTSW	15	101816369	missense	probably benign	0.22
R8805:Krt2	UTSW	15	101815944	missense	possibly damaging	0.93
R9051:Krt2	UTSW	15	101817882	missense	unknown
R9118:Krt2	UTSW	15	101814541	missense	probably damaging	0.99
R9230:Krt2	UTSW	15	101817513	missense	probably benign	0.39
R9257:Krt2	UTSW	15	101816491	missense	probably benign	0.05
R9424:Krt2	UTSW	15	101811357	missense	unknown
R9569:Krt2	UTSW	15	101816489	missense	probably damaging	1.00
R9576:Krt2	UTSW	15	101811357	missense	unknown
RF020:Krt2	UTSW	15	101817968	missense	unknown
Z1177:Krt2	UTSW	15	101811550	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGCACTAGGGAAGCACCTTG -3'
(R):5'- TGCCTATGCTAAATGAGACTCTG -3'

Sequencing Primer
(F):5'- GTGGCTGCGCTAAATCGAAACC -3'
(R):5'- AGACTCTGTGGAGATACAGTTCCTC -3'

Posted On

2019-05-15