Incidental Mutation 'R7104:Rbfox1'
ID551082
Institutional Source Beutler Lab
Gene Symbol Rbfox1
Ensembl Gene ENSMUSG00000008658
Gene NameRNA binding protein, fox-1 homolog (C. elegans) 1
SynonymsFOX1, A2bp, A2bp1, HRNBP1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7104 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location5885355-7411526 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 7353003 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 276 (R276S)
Ref Sequence ENSEMBL: ENSMUSP00000049970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056416] [ENSMUST00000115841] [ENSMUST00000229741] [ENSMUST00000230658] [ENSMUST00000231031] [ENSMUST00000231088] [ENSMUST00000231194]
Predicted Effect possibly damaging
Transcript: ENSMUST00000056416
AA Change: R276S

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000049970
Gene: ENSMUSG00000008658
AA Change: R276S

DomainStartEndE-ValueType
low complexity region 107 118 N/A INTRINSIC
RRM 137 208 1.77e-24 SMART
Pfam:Fox-1_C 272 362 1.7e-42 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115841
AA Change: R276S

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000111507
Gene: ENSMUSG00000008658
AA Change: R276S

DomainStartEndE-ValueType
low complexity region 87 98 N/A INTRINSIC
RRM 117 188 1.77e-24 SMART
Pfam:Fox-1_C 252 341 2.5e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000229741
AA Change: R296S

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000230658
AA Change: R276S

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably damaging
Transcript: ENSMUST00000231031
AA Change: R12S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect possibly damaging
Transcript: ENSMUST00000231088
AA Change: R238S

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000231194
AA Change: R276S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fox-1 family of RNA-binding proteins is evolutionarily conserved, and regulates tissue-specific alternative splicing in metazoa. Fox-1 recognizes a (U)GCAUG stretch in regulated exons or in flanking introns. The protein binds to the C-terminus of ataxin-2 and may contribute to the restricted pathology of spinocerebellar ataxia type 2 (SCA2). Ataxin-2 is the product of the SCA2 gene which causes familial neurodegenerative diseases. Fox-1 and ataxin-2 are both localized in the trans-Golgi network. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a conditional allele activated in the brain exhibit reduced fertility, infrequent spontaneous seizures, increased susceptibility to kainic acid-induced seizures and lethality, and increased neuronal excitation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,194,444 L897P possibly damaging Het
Agbl2 A G 2: 90,797,547 E232G probably damaging Het
Atf7 A G 15: 102,534,235 S480P probably benign Het
Cdk14 A G 5: 5,195,325 I166T possibly damaging Het
Cdk5rap2 G T 4: 70,349,156 F358L probably benign Het
Cytip A G 2: 58,159,974 S28P probably benign Het
Dennd5b C T 6: 149,044,604 R503Q probably damaging Het
Dnajc10 T A 2: 80,340,815 C480S probably damaging Het
Drc7 A G 8: 95,059,083 D189G probably damaging Het
Engase G A 11: 118,481,295 V138M probably damaging Het
Esyt3 C A 9: 99,338,787 R121L probably damaging Het
Frem1 T G 4: 82,940,681 I1516L probably benign Het
Gatad2b T A 3: 90,351,417 I249N probably damaging Het
Grk6 T C 13: 55,454,406 S383P probably benign Het
Hectd1 C T 12: 51,827,351 probably null Het
Hipk2 A G 6: 38,818,644 L230P probably damaging Het
Hivep1 A T 13: 42,157,338 Q1018L probably benign Het
Itgad T C 7: 128,198,378 F927S probably benign Het
Itgb3bp A G 4: 99,814,098 V3A probably damaging Het
Kcnh7 G T 2: 62,787,687 A486D possibly damaging Het
Krt2 T C 15: 101,815,087 T318A probably benign Het
Ndrg1 A G 15: 66,946,528 F77S probably damaging Het
Nlrp4c T A 7: 6,065,709 L203* probably null Het
Nos1 T A 5: 117,947,431 C1275S probably damaging Het
Olfr1052 T A 2: 86,298,220 S135T probably benign Het
Olfr1167 T C 2: 88,149,372 T216A possibly damaging Het
Olfr1241 A G 2: 89,483,114 V7A possibly damaging Het
Olfr1431 T C 19: 12,209,878 I104T possibly damaging Het
Olfr294 T C 7: 86,615,692 S318G probably null Het
Olfr875 A T 9: 37,773,141 N161Y possibly damaging Het
Pip4k2b T C 11: 97,732,716 M67V possibly damaging Het
Polq C A 16: 37,089,353 Y2366* probably null Het
Prg3 T C 2: 84,988,753 S8P probably benign Het
Prl7c1 A T 13: 27,778,969 L17* probably null Het
Prl8a8 A T 13: 27,511,496 S51R probably damaging Het
Pttg1 G C 11: 43,421,149 P160A probably benign Het
Rnase2a T G 14: 51,255,531 M126L probably benign Het
Secisbp2 A T 13: 51,656,907 K202* probably null Het
Sema6c A G 3: 95,168,845 H236R possibly damaging Het
Sept12 A G 16: 4,991,993 L181P probably damaging Het
Shc3 A T 13: 51,431,205 V458D possibly damaging Het
Tecta A G 9: 42,366,943 Y1090H probably benign Het
Thsd7a A T 6: 12,379,430 N998K Het
Tmem131l A T 3: 83,919,459 S1184T possibly damaging Het
Tnfsf15 T C 4: 63,729,650 D251G probably damaging Het
Ttyh3 T C 5: 140,629,785 E348G probably benign Het
Unc5c T C 3: 141,733,904 L186P probably damaging Het
Vmn2r37 A T 7: 9,216,046 N446K probably damaging Het
Vmn2r63 T C 7: 42,928,535 D193G possibly damaging Het
Vmn2r85 A T 10: 130,426,507 M121K probably benign Het
Vmn2r88 A G 14: 51,413,796 D189G Het
Vwc2l C A 1: 70,729,093 C105* probably null Het
Wdr72 T A 9: 74,148,315 D275E probably damaging Het
Zfhx4 A T 3: 5,402,489 D2594V probably damaging Het
Zfp174 C T 16: 3,854,405 H273Y probably benign Het
Zwilch A G 9: 64,161,376 S203P probably damaging Het
Other mutations in Rbfox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Rbfox1 APN 16 7369834 missense probably benign 0.02
IGL01070:Rbfox1 APN 16 7306443 missense possibly damaging 0.78
IGL02633:Rbfox1 APN 16 7292214 missense probably damaging 0.99
IGL03037:Rbfox1 APN 16 7292283 splice site probably benign
R0006:Rbfox1 UTSW 16 7330420 missense probably benign 0.21
R0647:Rbfox1 UTSW 16 7224384 missense probably damaging 1.00
R1439:Rbfox1 UTSW 16 7330433 missense possibly damaging 0.51
R1656:Rbfox1 UTSW 16 7306469 splice site probably benign
R1677:Rbfox1 UTSW 16 7292227 missense possibly damaging 0.92
R2155:Rbfox1 UTSW 16 7294082 missense possibly damaging 0.91
R3236:Rbfox1 UTSW 16 7408028 missense possibly damaging 0.94
R4952:Rbfox1 UTSW 16 7277088 missense probably benign 0.00
R4971:Rbfox1 UTSW 16 7294088 missense probably damaging 1.00
R5115:Rbfox1 UTSW 16 7409772 missense probably damaging 1.00
R5784:Rbfox1 UTSW 16 7224339 missense probably damaging 0.96
R6380:Rbfox1 UTSW 16 7224350 nonsense probably null
R7102:Rbfox1 UTSW 16 7369834 missense probably benign 0.02
R7218:Rbfox1 UTSW 16 7294083 missense probably damaging 1.00
R7348:Rbfox1 UTSW 16 7408024 nonsense probably null
R7383:Rbfox1 UTSW 16 7070035 missense probably benign 0.17
R7903:Rbfox1 UTSW 16 7224511 missense probably benign 0.20
R8161:Rbfox1 UTSW 16 7277028 missense
Predicted Primers PCR Primer
(F):5'- CTGTTTCAGGTGTGCAGCAC -3'
(R):5'- TTCAGGTAGGGTGGTCAAGAC -3'

Sequencing Primer
(F):5'- CCATCTTGCTAATAGAGAGTAGGCTG -3'
(R):5'- TCAAGACCATCATGCGTTGG -3'
Posted On2019-05-15