Incidental Mutation 'R7105:Olfr1018'
Institutional Source Beutler Lab
Gene Symbol Olfr1018
Ensembl Gene ENSMUSG00000043892
Gene Nameolfactory receptor 1018
SynonymsGA_x6K02T2Q125-47301584-47302519, MOR260-5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R7105 (G1)
Quality Score225.009
Status Validated
Chromosomal Location85818479-85824221 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 85823880 bp
Amino Acid Change Arginine to Methionine at position 303 (R303M)
Ref Sequence ENSEMBL: ENSMUSP00000151090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054201] [ENSMUST00000214416]
Predicted Effect probably benign
Transcript: ENSMUST00000054201
AA Change: R303M

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000050833
Gene: ENSMUSG00000043892
AA Change: R303M

Pfam:7tm_4 32 309 4.1e-59 PFAM
Pfam:7tm_1 42 291 1.2e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214416
AA Change: R303M

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (65/68)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,397,842 I3565N probably damaging Het
Adam8 T C 7: 139,990,055 E99G probably benign Het
Adnp2 A C 18: 80,128,151 H1014Q possibly damaging Het
Agbl4 T A 4: 111,566,723 N315K probably benign Het
Ankrd33b G T 15: 31,305,068 N183K probably damaging Het
Arhgef39 A G 4: 43,498,913 S113P possibly damaging Het
Bdp1 G A 13: 100,070,181 P618S probably damaging Het
Bhlhe40 C T 6: 108,665,036 P314S possibly damaging Het
Birc2 A C 9: 7,819,441 I490S probably damaging Het
Blm T C 7: 80,499,768 I698V probably benign Het
C4b G A 17: 34,730,911 T1433M possibly damaging Het
C87499 G A 4: 88,630,102 S22F probably damaging Het
Car12 A G 9: 66,752,406 T238A probably damaging Het
Cend1 G A 7: 141,427,652 P85L probably benign Het
Cftr A T 6: 18,318,972 D1337V probably damaging Het
Chsy3 T A 18: 59,176,419 M248K probably damaging Het
Chtf8 A G 8: 106,885,251 F352S probably damaging Het
Csf2ra T C 19: 61,225,020 D384G possibly damaging Het
Ctnnbip1 T C 4: 149,546,480 S59P probably benign Het
Cyth3 A G 5: 143,707,272 N312D probably benign Het
Dtnb T C 12: 3,648,391 probably null Het
Duox2 A G 2: 122,289,552 S826P possibly damaging Het
Enthd1 C T 15: 80,509,209 A273T probably benign Het
Gm13084 T C 4: 143,810,771 N330S probably benign Het
Gm3138 T C 14: 4,252,479 V159A possibly damaging Het
Hhip T C 8: 79,975,009 D632G probably benign Het
Igfn1 A T 1: 135,984,218 C114S probably benign Het
Islr2 T C 9: 58,197,814 D765G probably damaging Het
Klf14 TCCCC TCCC 6: 30,958,541 probably null Het
Mapk12 G A 15: 89,131,158 P362L probably benign Het
Msi1 T G 5: 115,433,870 F96V probably damaging Het
Mthfd1l T C 10: 4,103,261 V870A probably benign Het
Nfat5 T C 8: 107,369,191 S1355P possibly damaging Het
Oplah T C 15: 76,297,687 N1079D probably damaging Het
Osbpl1a T A 18: 12,766,963 I645F probably benign Het
Pank4 T C 4: 154,980,167 S728P probably benign Het
Parp2 TTGCCATAAGTGCTAAATGAAGCC T 14: 50,810,064 probably null Het
Piezo1 A G 8: 122,482,118 I2503T unknown Het
Plekhg6 A G 6: 125,378,805 L12P probably damaging Het
Plekhs1 T A 19: 56,477,215 F204Y probably damaging Het
Prep T A 10: 45,126,063 I438N probably benign Het
Prss58 T C 6: 40,897,766 H47R probably damaging Het
Rad51ap2 T G 12: 11,458,277 D733E possibly damaging Het
Robo1 A T 16: 72,742,161 I31F probably damaging Het
Setd2 A G 9: 110,548,260 Y381C probably damaging Het
Slc47a2 A G 11: 61,342,443 V87A probably benign Het
Slc5a9 T C 4: 111,898,695 N2S probably benign Het
Spata13 A G 14: 60,753,870 D1024G probably damaging Het
Stat1 T G 1: 52,151,249 N554K probably benign Het
Suclg2 T C 6: 95,595,654 D110G possibly damaging Het
Sult1c1 T A 17: 53,973,889 probably null Het
Taf5l A G 8: 124,003,212 I246T probably damaging Het
Tcof1 A T 18: 60,843,296 D80E probably damaging Het
Tex33 T A 15: 78,386,118 D150V possibly damaging Het
Tmem233 T C 5: 116,082,998 Y63C probably damaging Het
Tshz3 A G 7: 36,769,756 E390G probably damaging Het
Ttn T C 2: 76,730,266 T29264A possibly damaging Het
Ubr5 T C 15: 38,008,775 T1065A Het
Vcp A G 4: 42,985,991 V341A probably damaging Het
Vmn1r176 A T 7: 23,835,323 L135* probably null Het
Vmn1r57 T A 7: 5,220,500 I8N probably damaging Het
Ythdc2 C T 18: 44,834,563 P209S probably damaging Het
Zfp213 A T 17: 23,558,204 V288D probably benign Het
Zfp362 T C 4: 128,774,526 I418V probably damaging Het
Zfp707 C A 15: 75,974,746 T215K Het
Zfp957 G C 14: 79,212,962 R466G probably benign Het
Other mutations in Olfr1018
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Olfr1018 APN 2 85822988 missense probably benign 0.00
IGL02795:Olfr1018 APN 2 85823512 nonsense probably null
IGL03189:Olfr1018 APN 2 85823558 missense probably benign 0.27
IGL03329:Olfr1018 APN 2 85823385 missense probably benign 0.02
IGL03400:Olfr1018 APN 2 85823750 missense probably damaging 1.00
G1patch:Olfr1018 UTSW 2 85823790 missense probably damaging 0.97
IGL02796:Olfr1018 UTSW 2 85823589 missense probably benign 0.00
R5322:Olfr1018 UTSW 2 85823187 missense probably damaging 0.99
R5597:Olfr1018 UTSW 2 85823460 missense probably damaging 0.96
R6521:Olfr1018 UTSW 2 85823450 missense probably benign 0.01
R6725:Olfr1018 UTSW 2 85823790 missense probably damaging 0.97
R7068:Olfr1018 UTSW 2 85823052 missense probably benign 0.00
R8011:Olfr1018 UTSW 2 85823613 missense possibly damaging 0.90
R8294:Olfr1018 UTSW 2 85823187 missense probably damaging 0.99
Z1176:Olfr1018 UTSW 2 85823021 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-05-15