Incidental Mutation 'R7105:Gm13084'
Institutional Source Beutler Lab
Gene Symbol Gm13084
Ensembl Gene ENSMUSG00000059218
Gene Namepredicted gene 13084
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R7105 (G1)
Quality Score225.009
Status Not validated
Chromosomal Location143809245-143816093 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 143810771 bp
Amino Acid Change Asparagine to Serine at position 330 (N330S)
Ref Sequence ENSEMBL: ENSMUSP00000074557 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075045] [ENSMUST00000105769]
Predicted Effect probably benign
Transcript: ENSMUST00000075045
AA Change: N330S

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000074557
Gene: ENSMUSG00000059218
AA Change: N330S

SCOP:d1a4ya_ 222 409 9e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105769
AA Change: N330S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101395
Gene: ENSMUSG00000059218
AA Change: N330S

low complexity region 223 238 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (65/68)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,397,842 I3565N probably damaging Het
Adam8 T C 7: 139,990,055 E99G probably benign Het
Adnp2 A C 18: 80,128,151 H1014Q possibly damaging Het
Agbl4 T A 4: 111,566,723 N315K probably benign Het
Ankrd33b G T 15: 31,305,068 N183K probably damaging Het
Arhgef39 A G 4: 43,498,913 S113P possibly damaging Het
Bdp1 G A 13: 100,070,181 P618S probably damaging Het
Bhlhe40 C T 6: 108,665,036 P314S possibly damaging Het
Birc2 A C 9: 7,819,441 I490S probably damaging Het
Blm T C 7: 80,499,768 I698V probably benign Het
C4b G A 17: 34,730,911 T1433M possibly damaging Het
C87499 G A 4: 88,630,102 S22F probably damaging Het
Car12 A G 9: 66,752,406 T238A probably damaging Het
Cend1 G A 7: 141,427,652 P85L probably benign Het
Cftr A T 6: 18,318,972 D1337V probably damaging Het
Chsy3 T A 18: 59,176,419 M248K probably damaging Het
Chtf8 A G 8: 106,885,251 F352S probably damaging Het
Csf2ra T C 19: 61,225,020 D384G possibly damaging Het
Ctnnbip1 T C 4: 149,546,480 S59P probably benign Het
Cyth3 A G 5: 143,707,272 N312D probably benign Het
Dtnb T C 12: 3,648,391 probably null Het
Duox2 A G 2: 122,289,552 S826P possibly damaging Het
Enthd1 C T 15: 80,509,209 A273T probably benign Het
Gm3138 T C 14: 4,252,479 V159A possibly damaging Het
Hhip T C 8: 79,975,009 D632G probably benign Het
Igfn1 A T 1: 135,984,218 C114S probably benign Het
Islr2 T C 9: 58,197,814 D765G probably damaging Het
Klf14 TCCCC TCCC 6: 30,958,541 probably null Het
Mapk12 G A 15: 89,131,158 P362L probably benign Het
Msi1 T G 5: 115,433,870 F96V probably damaging Het
Mthfd1l T C 10: 4,103,261 V870A probably benign Het
Nfat5 T C 8: 107,369,191 S1355P possibly damaging Het
Olfr1018 G T 2: 85,823,880 R303M probably benign Het
Oplah T C 15: 76,297,687 N1079D probably damaging Het
Osbpl1a T A 18: 12,766,963 I645F probably benign Het
Pank4 T C 4: 154,980,167 S728P probably benign Het
Parp2 TTGCCATAAGTGCTAAATGAAGCC T 14: 50,810,064 probably null Het
Piezo1 A G 8: 122,482,118 I2503T unknown Het
Plekhg6 A G 6: 125,378,805 L12P probably damaging Het
Plekhs1 T A 19: 56,477,215 F204Y probably damaging Het
Prep T A 10: 45,126,063 I438N probably benign Het
Prss58 T C 6: 40,897,766 H47R probably damaging Het
Rad51ap2 T G 12: 11,458,277 D733E possibly damaging Het
Robo1 A T 16: 72,742,161 I31F probably damaging Het
Setd2 A G 9: 110,548,260 Y381C probably damaging Het
Slc47a2 A G 11: 61,342,443 V87A probably benign Het
Slc5a9 T C 4: 111,898,695 N2S probably benign Het
Spata13 A G 14: 60,753,870 D1024G probably damaging Het
Stat1 T G 1: 52,151,249 N554K probably benign Het
Suclg2 T C 6: 95,595,654 D110G possibly damaging Het
Sult1c1 T A 17: 53,973,889 probably null Het
Taf5l A G 8: 124,003,212 I246T probably damaging Het
Tcof1 A T 18: 60,843,296 D80E probably damaging Het
Tex33 T A 15: 78,386,118 D150V possibly damaging Het
Tmem233 T C 5: 116,082,998 Y63C probably damaging Het
Tshz3 A G 7: 36,769,756 E390G probably damaging Het
Ttn T C 2: 76,730,266 T29264A possibly damaging Het
Ubr5 T C 15: 38,008,775 T1065A Het
Vcp A G 4: 42,985,991 V341A probably damaging Het
Vmn1r176 A T 7: 23,835,323 L135* probably null Het
Vmn1r57 T A 7: 5,220,500 I8N probably damaging Het
Ythdc2 C T 18: 44,834,563 P209S probably damaging Het
Zfp213 A T 17: 23,558,204 V288D probably benign Het
Zfp362 T C 4: 128,774,526 I418V probably damaging Het
Zfp707 C A 15: 75,974,746 T215K Het
Zfp957 G C 14: 79,212,962 R466G probably benign Het
Other mutations in Gm13084
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Gm13084 APN 4 143812723 missense probably benign 0.32
IGL01075:Gm13084 APN 4 143811646 missense possibly damaging 0.47
IGL02705:Gm13084 APN 4 143810802 missense probably damaging 1.00
IGL03011:Gm13084 APN 4 143811760 missense possibly damaging 0.95
PIT4498001:Gm13084 UTSW 4 143812836 missense possibly damaging 0.63
R0268:Gm13084 UTSW 4 143810768 missense probably damaging 1.00
R0344:Gm13084 UTSW 4 143810768 missense probably damaging 1.00
R0390:Gm13084 UTSW 4 143811699 missense probably benign 0.09
R0597:Gm13084 UTSW 4 143812652 missense probably damaging 0.98
R0646:Gm13084 UTSW 4 143812585 missense possibly damaging 0.83
R0927:Gm13084 UTSW 4 143812808 missense probably benign 0.05
R0973:Gm13084 UTSW 4 143811858 missense probably damaging 1.00
R1851:Gm13084 UTSW 4 143812826 missense probably benign 0.33
R1852:Gm13084 UTSW 4 143812826 missense probably benign 0.33
R3699:Gm13084 UTSW 4 143810352 missense probably benign 0.05
R3705:Gm13084 UTSW 4 143811775 missense probably benign 0.06
R3845:Gm13084 UTSW 4 143811975 missense probably damaging 0.96
R4035:Gm13084 UTSW 4 143810456 missense probably benign 0.08
R4044:Gm13084 UTSW 4 143811600 missense probably benign 0.34
R4439:Gm13084 UTSW 4 143811573 missense possibly damaging 0.49
R4660:Gm13084 UTSW 4 143811865 missense probably benign 0.19
R4770:Gm13084 UTSW 4 143811949 missense probably damaging 0.96
R4838:Gm13084 UTSW 4 143810805 nonsense probably null
R5534:Gm13084 UTSW 4 143812599 nonsense probably null
R5691:Gm13084 UTSW 4 143812009 missense probably benign 0.44
R5893:Gm13084 UTSW 4 143810468 missense probably damaging 1.00
R6123:Gm13084 UTSW 4 143812764 missense possibly damaging 0.89
R6285:Gm13084 UTSW 4 143816039 missense probably damaging 1.00
R6886:Gm13084 UTSW 4 143812762 missense probably benign 0.29
R7135:Gm13084 UTSW 4 143810663 missense probably damaging 1.00
R7474:Gm13084 UTSW 4 143811699 missense probably benign 0.03
R7594:Gm13084 UTSW 4 143812716 missense probably damaging 0.99
R7610:Gm13084 UTSW 4 143812866 missense probably damaging 1.00
R7635:Gm13084 UTSW 4 143810417 missense probably damaging 1.00
R7682:Gm13084 UTSW 4 143810720 missense probably benign 0.38
R7986:Gm13084 UTSW 4 143812020 nonsense probably null
R8222:Gm13084 UTSW 4 143810323 missense possibly damaging 0.61
R8328:Gm13084 UTSW 4 143810810 missense probably damaging 1.00
R8678:Gm13084 UTSW 4 143812006 missense probably benign 0.21
Z1177:Gm13084 UTSW 4 143812018 missense probably benign 0.17
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-05-15