Incidental Mutation 'R7105:Cyth3'
ID551101
Institutional Source Beutler Lab
Gene Symbol Cyth3
Ensembl Gene ENSMUSG00000018001
Gene Namecytohesin 3
SynonymsGrp1, Pscd3, cytohesin 3
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.266) question?
Stock #R7105 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location143622447-143710250 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 143707272 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 312 (N312D)
Ref Sequence ENSEMBL: ENSMUSP00000112157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053287] [ENSMUST00000110727] [ENSMUST00000116456]
PDB Structure
GRP1 PH DOMAIN WITH INS(1,3,4,5)P4 [X-RAY DIFFRACTION]
GRP1 PH DOMAIN (UNLIGANDED) [X-RAY DIFFRACTION]
Structure of the pleckstrin homology domain from GRP1 in complex with inositol(1,3,4,5,6)pentakisphosphate [X-RAY DIFFRACTION]
Structure of the pleckstrin homology domain from GRP1 in complex with inositol 1,3,4,5-tetrakisphosphate [X-RAY DIFFRACTION]
Triglycine variant of the Grp1 Pleckstrin Homology Domain unliganded [X-RAY DIFFRACTION]
Crystal Structure of Autoinhibited Form of Grp1 Arf GTPase Exchange Factor [X-RAY DIFFRACTION]
Crystal Structure of Autoinhibited Form of Grp1 Arf GTPase Exchange Factor [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000053287
SMART Domains Protein: ENSMUSP00000053955
Gene: ENSMUSG00000051306

DomainStartEndE-ValueType
low complexity region 65 77 N/A INTRINSIC
Pfam:UCH 109 408 1.4e-46 PFAM
Pfam:UCH_1 110 391 1.4e-18 PFAM
low complexity region 470 490 N/A INTRINSIC
low complexity region 567 579 N/A INTRINSIC
low complexity region 604 613 N/A INTRINSIC
low complexity region 634 645 N/A INTRINSIC
low complexity region 954 962 N/A INTRINSIC
low complexity region 1016 1031 N/A INTRINSIC
low complexity region 1201 1219 N/A INTRINSIC
low complexity region 1239 1255 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110727
AA Change: N264D

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000106355
Gene: ENSMUSG00000018001
AA Change: N264D

DomainStartEndE-ValueType
Sec7 15 200 1.5e-106 SMART
PH 217 334 1.1e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116456
AA Change: N312D

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000112157
Gene: ENSMUSG00000018001
AA Change: N312D

DomainStartEndE-ValueType
low complexity region 3 10 N/A INTRINSIC
low complexity region 14 35 N/A INTRINSIC
Sec7 63 248 3.21e-104 SMART
PH 265 382 2.36e-24 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (65/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the PSCD (pleckstrin homology, Sec7 and coiled-coil domains) family. PSCD family members have identical structural organization that consists of an N-terminal coiled-coil motif, a central Sec7 domain, and a C-terminal pleckstrin homology (PH) domain. The coiled-coil motif is involved in homodimerization, the Sec7 domain contains guanine-nucleotide exchange protein (GEP) activity, and the PH domain interacts with phospholipids and is responsible for association of PSCDs with membranes. Members of this family appear to mediate the regulation of protein sorting and membrane trafficking. This encoded protein is involved in the control of Golgi structure and function, and it may have a physiological role in regulating ADP-ribosylation factor protein 6 (ARF) functions, in addition to acting on ARF1. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,397,842 I3565N probably damaging Het
Adam8 T C 7: 139,990,055 E99G probably benign Het
Adnp2 A C 18: 80,128,151 H1014Q possibly damaging Het
Agbl4 T A 4: 111,566,723 N315K probably benign Het
Ankrd33b G T 15: 31,305,068 N183K probably damaging Het
Arhgef39 A G 4: 43,498,913 S113P possibly damaging Het
Bdp1 G A 13: 100,070,181 P618S probably damaging Het
Bhlhe40 C T 6: 108,665,036 P314S possibly damaging Het
Birc2 A C 9: 7,819,441 I490S probably damaging Het
Blm T C 7: 80,499,768 I698V probably benign Het
C4b G A 17: 34,730,911 T1433M possibly damaging Het
C87499 G A 4: 88,630,102 S22F probably damaging Het
Car12 A G 9: 66,752,406 T238A probably damaging Het
Cend1 G A 7: 141,427,652 P85L probably benign Het
Cftr A T 6: 18,318,972 D1337V probably damaging Het
Chsy3 T A 18: 59,176,419 M248K probably damaging Het
Chtf8 A G 8: 106,885,251 F352S probably damaging Het
Csf2ra T C 19: 61,225,020 D384G possibly damaging Het
Ctnnbip1 T C 4: 149,546,480 S59P probably benign Het
Dtnb T C 12: 3,648,391 probably null Het
Duox2 A G 2: 122,289,552 S826P possibly damaging Het
Enthd1 C T 15: 80,509,209 A273T probably benign Het
Gm13084 T C 4: 143,810,771 N330S probably benign Het
Gm3138 T C 14: 4,252,479 V159A possibly damaging Het
Hhip T C 8: 79,975,009 D632G probably benign Het
Igfn1 A T 1: 135,984,218 C114S probably benign Het
Islr2 T C 9: 58,197,814 D765G probably damaging Het
Klf14 TCCCC TCCC 6: 30,958,541 probably null Het
Mapk12 G A 15: 89,131,158 P362L probably benign Het
Msi1 T G 5: 115,433,870 F96V probably damaging Het
Mthfd1l T C 10: 4,103,261 V870A probably benign Het
Nfat5 T C 8: 107,369,191 S1355P possibly damaging Het
Olfr1018 G T 2: 85,823,880 R303M probably benign Het
Oplah T C 15: 76,297,687 N1079D probably damaging Het
Osbpl1a T A 18: 12,766,963 I645F probably benign Het
Pank4 T C 4: 154,980,167 S728P probably benign Het
Parp2 TTGCCATAAGTGCTAAATGAAGCC T 14: 50,810,064 probably null Het
Piezo1 A G 8: 122,482,118 I2503T unknown Het
Plekhg6 A G 6: 125,378,805 L12P probably damaging Het
Plekhs1 T A 19: 56,477,215 F204Y probably damaging Het
Prep T A 10: 45,126,063 I438N probably benign Het
Prss58 T C 6: 40,897,766 H47R probably damaging Het
Rad51ap2 T G 12: 11,458,277 D733E possibly damaging Het
Robo1 A T 16: 72,742,161 I31F probably damaging Het
Setd2 A G 9: 110,548,260 Y381C probably damaging Het
Slc47a2 A G 11: 61,342,443 V87A probably benign Het
Slc5a9 T C 4: 111,898,695 N2S probably benign Het
Spata13 A G 14: 60,753,870 D1024G probably damaging Het
Stat1 T G 1: 52,151,249 N554K probably benign Het
Suclg2 T C 6: 95,595,654 D110G possibly damaging Het
Sult1c1 T A 17: 53,973,889 probably null Het
Taf5l A G 8: 124,003,212 I246T probably damaging Het
Tcof1 A T 18: 60,843,296 D80E probably damaging Het
Tex33 T A 15: 78,386,118 D150V possibly damaging Het
Tmem233 T C 5: 116,082,998 Y63C probably damaging Het
Tshz3 A G 7: 36,769,756 E390G probably damaging Het
Ttn T C 2: 76,730,266 T29264A possibly damaging Het
Ubr5 T C 15: 38,008,775 T1065A Het
Vcp A G 4: 42,985,991 V341A probably damaging Het
Vmn1r176 A T 7: 23,835,323 L135* probably null Het
Vmn1r57 T A 7: 5,220,500 I8N probably damaging Het
Ythdc2 C T 18: 44,834,563 P209S probably damaging Het
Zfp213 A T 17: 23,558,204 V288D probably benign Het
Zfp362 T C 4: 128,774,526 I418V probably damaging Het
Zfp707 C A 15: 75,974,746 T215K Het
Zfp957 G C 14: 79,212,962 R466G probably benign Het
Other mutations in Cyth3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Cyth3 APN 5 143707165 splice site probably null
IGL01340:Cyth3 APN 5 143684435 nonsense probably null
IGL01372:Cyth3 APN 5 143692638 missense possibly damaging 0.93
IGL02092:Cyth3 APN 5 143707385 splice site probably benign
IGL02850:Cyth3 APN 5 143686504 missense probably damaging 0.97
IGL02892:Cyth3 APN 5 143707437 missense possibly damaging 0.86
R0373:Cyth3 UTSW 5 143684426 utr 5 prime probably benign
R0726:Cyth3 UTSW 5 143692642 missense probably benign 0.00
R1217:Cyth3 UTSW 5 143702820 missense probably damaging 1.00
R1552:Cyth3 UTSW 5 143697750 missense probably benign 0.12
R1623:Cyth3 UTSW 5 143701372 missense probably damaging 1.00
R1873:Cyth3 UTSW 5 143697761 missense possibly damaging 0.54
R3788:Cyth3 UTSW 5 143636543 intron probably benign
R4736:Cyth3 UTSW 5 143684479 critical splice donor site probably null
R6500:Cyth3 UTSW 5 143707840 missense probably damaging 0.97
R6824:Cyth3 UTSW 5 143686510 missense probably damaging 1.00
R7143:Cyth3 UTSW 5 143684396 missense unknown
R7767:Cyth3 UTSW 5 143707474 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGTGTGAAGACCTGGAAACG -3'
(R):5'- TACACAACGTGGTTGCCCTC -3'

Sequencing Primer
(F):5'- AAACGGCGCTGGTTCATC -3'
(R):5'- CGTCTTGCAGGCCTTGATGAC -3'
Posted On2019-05-15