Incidental Mutation 'R0597:Fbxl13'
ID55111
Institutional Source Beutler Lab
Gene Symbol Fbxl13
Ensembl Gene ENSMUSG00000048520
Gene NameF-box and leucine-rich repeat protein 13
Synonyms4921539K22Rik
MMRRC Submission 038786-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0597 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location21483847-21645634 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21614714 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 229 (I229T)
Ref Sequence ENSEMBL: ENSMUSP00000110889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051358] [ENSMUST00000115234]
Predicted Effect probably benign
Transcript: ENSMUST00000051358
AA Change: I229T

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000052716
Gene: ENSMUSG00000048520
AA Change: I229T

DomainStartEndE-ValueType
low complexity region 160 173 N/A INTRINSIC
FBOX 243 283 3.73e-4 SMART
LRR_CC 328 353 6.62e-6 SMART
LRR 354 378 3.67e2 SMART
LRR 379 404 2.75e-3 SMART
LRR 407 425 4.51e2 SMART
LRR 426 451 2.63e0 SMART
LRR 476 501 4.15e1 SMART
LRR 502 526 1.82e1 SMART
LRR 529 554 1.76e-1 SMART
LRR_CC 555 580 4.61e-5 SMART
LRR 604 629 8.81e-2 SMART
LRR 630 655 2.37e1 SMART
LRR 656 681 3.21e-4 SMART
LRR 682 707 6.57e-1 SMART
LRR 708 733 9.47e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115234
AA Change: I229T

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000110889
Gene: ENSMUSG00000048520
AA Change: I229T

DomainStartEndE-ValueType
low complexity region 160 173 N/A INTRINSIC
FBOX 243 283 3.73e-4 SMART
LRR_CC 328 353 6.62e-6 SMART
LRR 354 378 3.67e2 SMART
LRR 379 404 2.75e-3 SMART
LRR 407 432 6.88e-4 SMART
Blast:LRR 433 458 7e-8 BLAST
LRR 459 484 2.63e0 SMART
LRR 509 534 4.15e1 SMART
LRR 535 559 1.82e1 SMART
LRR 562 587 1.76e-1 SMART
LRR_CC 588 613 4.61e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137788
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199822
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 99.0%
  • 10x: 97.4%
  • 20x: 94.1%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the F-box protein family, such as FBXL13, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy10 T C 1: 165,525,062 probably null Het
Anxa11 T C 14: 25,874,228 I221T probably damaging Het
Arhgap33 C G 7: 30,526,446 R565P probably damaging Het
Bmpr2 T C 1: 59,841,425 probably benign Het
Btn2a2 T A 13: 23,486,410 H51L probably benign Het
Casz1 T C 4: 148,944,394 S1099P probably benign Het
Cnot4 A G 6: 35,051,503 S393P possibly damaging Het
Cntnap5a T C 1: 116,184,461 probably benign Het
Cobl T C 11: 12,254,699 T586A probably benign Het
Crocc A G 4: 141,017,071 L1838P probably benign Het
Crocc T C 4: 141,019,913 K1528R probably benign Het
Dact2 A G 17: 14,197,041 V299A probably benign Het
Dapk1 C A 13: 60,761,384 N1270K probably benign Het
Ddx41 T C 13: 55,533,006 Y375C probably damaging Het
Dock5 T A 14: 67,784,934 probably null Het
Dyrk4 T G 6: 126,886,649 probably null Het
Eno1b T C 18: 48,047,739 I328T probably benign Het
Fam210b A G 2: 172,345,853 probably benign Het
Fbxo39 A G 11: 72,316,921 D33G probably damaging Het
Fbxw11 A G 11: 32,720,496 E120G probably damaging Het
Fbxw2 A T 2: 34,811,020 L261Q probably damaging Het
Gm13084 G T 4: 143,812,652 N90K probably damaging Het
Gm5800 A C 14: 51,716,004 N51K probably benign Het
Gm6899 A G 11: 26,593,768 probably benign Het
Gm9745 C A 13: 8,940,766 probably benign Het
Gpx8 T C 13: 113,045,501 T133A possibly damaging Het
Grin3a C T 4: 49,665,351 V1095M probably damaging Het
Grip2 T C 6: 91,796,197 probably benign Het
Hacd4 A G 4: 88,437,520 F43L probably damaging Het
Hif1a T G 12: 73,942,275 S645R probably benign Het
Hipk3 A G 2: 104,433,637 S839P possibly damaging Het
Il16 A T 7: 83,677,975 probably benign Het
Il3ra T A 14: 14,351,166 probably null Het
Il5ra A G 6: 106,744,335 M1T probably null Het
Klra2 G A 6: 131,220,185 R251C probably benign Het
Lamc2 C T 1: 153,133,621 V813M probably benign Het
Lbr A G 1: 181,832,213 V139A probably benign Het
Lrp5 T C 19: 3,600,777 D1219G possibly damaging Het
Map3k6 C T 4: 133,245,552 P341S possibly damaging Het
Mcts2 A G 2: 152,687,689 E140G probably benign Het
Med1 T C 11: 98,169,438 M222V probably benign Het
Mef2a G T 7: 67,235,148 S406* probably null Het
Muc19 A T 15: 91,900,502 noncoding transcript Het
Nr1h2 A G 7: 44,552,260 probably benign Het
Olfr1361 C A 13: 21,659,146 R59L probably damaging Het
Olfr205 A T 16: 59,328,760 F250I probably damaging Het
Olfr682-ps1 A G 7: 105,128,218 V73A possibly damaging Het
Olfr71 A T 4: 43,706,592 probably null Het
P4hb G A 11: 120,568,244 T141I possibly damaging Het
Polr3a A G 14: 24,484,134 V101A probably benign Het
Pou4f2 A G 8: 78,435,240 S245P probably benign Het
Rnpep A G 1: 135,272,419 V266A probably damaging Het
Scly G A 1: 91,309,833 G206R probably damaging Het
Sec14l3 A T 11: 4,074,814 K254N probably damaging Het
Sgpp1 A T 12: 75,735,100 I155N probably damaging Het
Slc22a14 A G 9: 119,172,124 L468P probably damaging Het
Slc22a27 A G 19: 7,865,884 F377L probably benign Het
Slc44a3 T C 3: 121,460,070 I625V probably benign Het
Slc47a2 A T 11: 61,309,976 I373N probably damaging Het
Slfn10-ps A T 11: 83,035,653 noncoding transcript Het
Smarcd1 T A 15: 99,711,094 I383N probably damaging Het
Sort1 A G 3: 108,338,910 D401G probably damaging Het
Sprr2a3 G T 3: 92,288,590 M1I probably null Het
Sycp2 A C 2: 178,356,580 V1049G possibly damaging Het
Tecrl T A 5: 83,354,928 K10* probably null Het
Tnpo3 A T 6: 29,578,565 C303* probably null Het
Vmn2r23 A G 6: 123,729,721 I503M probably benign Het
Zbtb8os T A 4: 129,346,877 I164N probably damaging Het
Zfp292 T C 4: 34,807,399 N1882D probably benign Het
Zfp91 T C 19: 12,770,095 I555V possibly damaging Het
Other mutations in Fbxl13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01722:Fbxl13 APN 5 21490414 missense possibly damaging 0.81
IGL02178:Fbxl13 APN 5 21620720 missense possibly damaging 0.56
IGL02271:Fbxl13 APN 5 21490456 missense probably damaging 1.00
IGL02317:Fbxl13 APN 5 21522234 missense probably benign 0.28
IGL02508:Fbxl13 APN 5 21556805 critical splice donor site probably null
IGL02891:Fbxl13 APN 5 21522100 splice site probably benign
IGL03387:Fbxl13 APN 5 21523798 critical splice donor site probably null
laurel UTSW 5 21582053 nonsense probably null
PIT4305001:Fbxl13 UTSW 5 21522148 missense probably benign
R0040:Fbxl13 UTSW 5 21486373 missense probably damaging 1.00
R0040:Fbxl13 UTSW 5 21486373 missense probably damaging 1.00
R0278:Fbxl13 UTSW 5 21523910 missense probably benign 0.03
R1110:Fbxl13 UTSW 5 21484036 missense probably benign
R1172:Fbxl13 UTSW 5 21620604 splice site probably benign
R1175:Fbxl13 UTSW 5 21620604 splice site probably benign
R1464:Fbxl13 UTSW 5 21483991 missense probably benign 0.21
R1464:Fbxl13 UTSW 5 21483991 missense probably benign 0.21
R2174:Fbxl13 UTSW 5 21582048 missense possibly damaging 0.74
R2426:Fbxl13 UTSW 5 21522137 missense probably damaging 1.00
R4171:Fbxl13 UTSW 5 21543788 missense probably benign 0.02
R4413:Fbxl13 UTSW 5 21582053 nonsense probably null
R4655:Fbxl13 UTSW 5 21582039 missense probably damaging 1.00
R4816:Fbxl13 UTSW 5 21484003 missense probably benign 0.25
R5544:Fbxl13 UTSW 5 21524491 missense probably damaging 0.96
R5979:Fbxl13 UTSW 5 21582091 missense probably damaging 1.00
R6176:Fbxl13 UTSW 5 21500500 missense possibly damaging 0.83
R6211:Fbxl13 UTSW 5 21484021 missense possibly damaging 0.57
R6252:Fbxl13 UTSW 5 21621501 missense possibly damaging 0.96
R6336:Fbxl13 UTSW 5 21523547 critical splice donor site probably null
R6455:Fbxl13 UTSW 5 21556814 missense probably benign 0.02
R6522:Fbxl13 UTSW 5 21561556 unclassified probably null
R6827:Fbxl13 UTSW 5 21522178 missense probably damaging 0.97
R6961:Fbxl13 UTSW 5 21543742 missense probably damaging 1.00
R6998:Fbxl13 UTSW 5 21543689 missense probably damaging 1.00
R6998:Fbxl13 UTSW 5 21620613 missense probably null 0.03
R7152:Fbxl13 UTSW 5 21582067 missense possibly damaging 0.95
R7196:Fbxl13 UTSW 5 21486303 missense probably damaging 0.97
R7418:Fbxl13 UTSW 5 21581983 missense probably benign 0.00
R7490:Fbxl13 UTSW 5 21523060 nonsense probably null
R7649:Fbxl13 UTSW 5 21614666 missense probably benign 0.13
R7816:Fbxl13 UTSW 5 21543787 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- CGGAGTTGGTACTCTTACTTCCGC -3'
(R):5'- AGGAGATGACACCAGGTCTTTCAGG -3'

Sequencing Primer
(F):5'- TTCATCAGCCAGACTTCGG -3'
(R):5'- GGCCTGTGCCAATACTTATGAC -3'
Posted On2013-07-11