Incidental Mutation 'R7105:Taf5l'
ID551118
Institutional Source Beutler Lab
Gene Symbol Taf5l
Ensembl Gene ENSMUSG00000038697
Gene NameTATA-box binding protein associated factor 5 like
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R7105 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location123996318-124021397 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 124003212 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 246 (I246T)
Ref Sequence ENSEMBL: ENSMUSP00000090726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093039] [ENSMUST00000127664] [ENSMUST00000165628] [ENSMUST00000212010]
Predicted Effect probably damaging
Transcript: ENSMUST00000093039
AA Change: I246T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000090726
Gene: ENSMUSG00000038697
AA Change: I246T

DomainStartEndE-ValueType
Pfam:TFIID_NTD2 61 195 8.4e-35 PFAM
WD40 257 296 6.66e-1 SMART
WD40 331 370 3.19e-7 SMART
WD40 373 412 5.95e-7 SMART
WD40 415 454 2.2e-10 SMART
WD40 457 496 1.2e-11 SMART
WD40 499 538 5.3e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165628
AA Change: I246T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000128710
Gene: ENSMUSG00000038697
AA Change: I246T

DomainStartEndE-ValueType
Pfam:TFIID_90kDa 55 196 1.2e-43 PFAM
WD40 257 296 6.66e-1 SMART
WD40 331 370 3.19e-7 SMART
WD40 373 412 5.95e-7 SMART
WD40 415 454 2.2e-10 SMART
WD40 457 496 1.2e-11 SMART
WD40 499 538 5.3e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212010
Meta Mutation Damage Score 0.1906 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (65/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the WD-repeat TAF5 family of proteins. This gene encodes a protein that is a component of the PCAF histone acetylase complex. The PCAF histone acetylase complex, which is composed of more than 20 polypeptides some of which are TAFs, is required for myogenic transcription and differentiation. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors to facilitate complex assembly and transcription initiation. The encoded protein is structurally similar to one of the histone-like TAFs, TAF5. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,397,842 I3565N probably damaging Het
Adam8 T C 7: 139,990,055 E99G probably benign Het
Adnp2 A C 18: 80,128,151 H1014Q possibly damaging Het
Agbl4 T A 4: 111,566,723 N315K probably benign Het
Ankrd33b G T 15: 31,305,068 N183K probably damaging Het
Arhgef39 A G 4: 43,498,913 S113P possibly damaging Het
Bdp1 G A 13: 100,070,181 P618S probably damaging Het
Bhlhe40 C T 6: 108,665,036 P314S possibly damaging Het
Birc2 A C 9: 7,819,441 I490S probably damaging Het
Blm T C 7: 80,499,768 I698V probably benign Het
C4b G A 17: 34,730,911 T1433M possibly damaging Het
C87499 G A 4: 88,630,102 S22F probably damaging Het
Car12 A G 9: 66,752,406 T238A probably damaging Het
Cend1 G A 7: 141,427,652 P85L probably benign Het
Cftr A T 6: 18,318,972 D1337V probably damaging Het
Chsy3 T A 18: 59,176,419 M248K probably damaging Het
Chtf8 A G 8: 106,885,251 F352S probably damaging Het
Csf2ra T C 19: 61,225,020 D384G possibly damaging Het
Ctnnbip1 T C 4: 149,546,480 S59P probably benign Het
Cyth3 A G 5: 143,707,272 N312D probably benign Het
Dtnb T C 12: 3,648,391 probably null Het
Duox2 A G 2: 122,289,552 S826P possibly damaging Het
Enthd1 C T 15: 80,509,209 A273T probably benign Het
Gm13084 T C 4: 143,810,771 N330S probably benign Het
Gm3138 T C 14: 4,252,479 V159A possibly damaging Het
Hhip T C 8: 79,975,009 D632G probably benign Het
Igfn1 A T 1: 135,984,218 C114S probably benign Het
Islr2 T C 9: 58,197,814 D765G probably damaging Het
Klf14 TCCCC TCCC 6: 30,958,541 probably null Het
Mapk12 G A 15: 89,131,158 P362L probably benign Het
Msi1 T G 5: 115,433,870 F96V probably damaging Het
Mthfd1l T C 10: 4,103,261 V870A probably benign Het
Nfat5 T C 8: 107,369,191 S1355P possibly damaging Het
Olfr1018 G T 2: 85,823,880 R303M probably benign Het
Oplah T C 15: 76,297,687 N1079D probably damaging Het
Osbpl1a T A 18: 12,766,963 I645F probably benign Het
Pank4 T C 4: 154,980,167 S728P probably benign Het
Parp2 TTGCCATAAGTGCTAAATGAAGCC T 14: 50,810,064 probably null Het
Piezo1 A G 8: 122,482,118 I2503T unknown Het
Plekhg6 A G 6: 125,378,805 L12P probably damaging Het
Plekhs1 T A 19: 56,477,215 F204Y probably damaging Het
Prep T A 10: 45,126,063 I438N probably benign Het
Prss58 T C 6: 40,897,766 H47R probably damaging Het
Rad51ap2 T G 12: 11,458,277 D733E possibly damaging Het
Robo1 A T 16: 72,742,161 I31F probably damaging Het
Setd2 A G 9: 110,548,260 Y381C probably damaging Het
Slc47a2 A G 11: 61,342,443 V87A probably benign Het
Slc5a9 T C 4: 111,898,695 N2S probably benign Het
Spata13 A G 14: 60,753,870 D1024G probably damaging Het
Stat1 T G 1: 52,151,249 N554K probably benign Het
Suclg2 T C 6: 95,595,654 D110G possibly damaging Het
Sult1c1 T A 17: 53,973,889 probably null Het
Tcof1 A T 18: 60,843,296 D80E probably damaging Het
Tex33 T A 15: 78,386,118 D150V possibly damaging Het
Tmem233 T C 5: 116,082,998 Y63C probably damaging Het
Tshz3 A G 7: 36,769,756 E390G probably damaging Het
Ttn T C 2: 76,730,266 T29264A possibly damaging Het
Ubr5 T C 15: 38,008,775 T1065A Het
Vcp A G 4: 42,985,991 V341A probably damaging Het
Vmn1r176 A T 7: 23,835,323 L135* probably null Het
Vmn1r57 T A 7: 5,220,500 I8N probably damaging Het
Ythdc2 C T 18: 44,834,563 P209S probably damaging Het
Zfp213 A T 17: 23,558,204 V288D probably benign Het
Zfp362 T C 4: 128,774,526 I418V probably damaging Het
Zfp707 C A 15: 75,974,746 T215K Het
Zfp957 G C 14: 79,212,962 R466G probably benign Het
Other mutations in Taf5l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02850:Taf5l APN 8 124003458 missense possibly damaging 0.94
IGL03371:Taf5l APN 8 123997986 missense possibly damaging 0.52
Invalid UTSW 8 124002975 critical splice donor site probably null
R0017:Taf5l UTSW 8 124003644 missense probably damaging 1.00
R1708:Taf5l UTSW 8 124009770 nonsense probably null
R1813:Taf5l UTSW 8 124003413 missense probably damaging 1.00
R1861:Taf5l UTSW 8 123997990 missense probably damaging 1.00
R1896:Taf5l UTSW 8 124003413 missense probably damaging 1.00
R4570:Taf5l UTSW 8 123997550 missense probably damaging 1.00
R4656:Taf5l UTSW 8 123998105 missense probably benign
R5294:Taf5l UTSW 8 124008218 missense probably benign 0.11
R5335:Taf5l UTSW 8 124003651 missense probably damaging 1.00
R5480:Taf5l UTSW 8 124009820 missense possibly damaging 0.78
R5905:Taf5l UTSW 8 124002975 critical splice donor site probably null
R6028:Taf5l UTSW 8 124002975 critical splice donor site probably null
R8304:Taf5l UTSW 8 124003512 missense probably benign 0.03
R8337:Taf5l UTSW 8 123998102 missense probably benign 0.00
X0024:Taf5l UTSW 8 123998021 missense probably benign 0.04
Z1088:Taf5l UTSW 8 123997338 nonsense probably null
Z1176:Taf5l UTSW 8 123997362 missense probably benign 0.06
Z1177:Taf5l UTSW 8 124002999 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCACAAGCTAGACGGATCC -3'
(R):5'- GACAACAACACTGCCCTGTG -3'

Sequencing Primer
(F):5'- CTAGACGGATCCGGGATGTGTC -3'
(R):5'- GCCCTGTGCAAAGTGCTTG -3'
Posted On2019-05-15