Mutagenetix > Incidental Mutation

Incidental Mutation 'R7105:C4b'

551144

Institutional Source

Beutler Lab

Gene Symbol

C4b

Ensembl Gene

ENSMUSG00000073418

Gene Name

complement component 4B (Chido blood group)

Synonyms

C4, Ss

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7105 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

34728380-34743882 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 34730911 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 1433 (T1433M)

Ref Sequence

ENSEMBL: ENSMUSP00000069418 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069507]

AlphaFold

P01029

Predicted Effect

possibly damaging
Transcript: ENSMUST00000069507
AA Change: T1433M

PolyPhen 2 Score 0.516 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000069418
Gene: ENSMUSG00000073418
AA Change: T1433M

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:A2M_N	138	231	2e-19	PFAM
A2M_N_2	470	609	2.87e-26	SMART
ANATO	700	734	3.58e-12	SMART
low complexity region	761	771	N/A	INTRINSIC
A2M	779	867	1.46e-27	SMART
Pfam:Thiol-ester_cl	995	1024	7.7e-13	PFAM
Pfam:A2M_comp	1047	1313	1.3e-82	PFAM
low complexity region	1441	1447	N/A	INTRINSIC
A2M_recep	1475	1564	1.03e-36	SMART
C345C	1608	1720	5.69e-40	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000173057

SMART Domains

Protein: ENSMUSP00000134611
Gene: ENSMUSG00000073418

Domain	Start	End	E-Value	Type
Pfam:A2M	1	62	6.5e-20	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

96% (65/68)

MGI Phenotype

PHENOTYPE: Homozygous C4 deficient mice have compromised immune responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	A	11: 9,397,842	I3565N	probably damaging	Het
Adam8	T	C	7: 139,990,055	E99G	probably benign	Het
Adnp2	A	C	18: 80,128,151	H1014Q	possibly damaging	Het
Agbl4	T	A	4: 111,566,723	N315K	probably benign	Het
Ankrd33b	G	T	15: 31,305,068	N183K	probably damaging	Het
Arhgef39	A	G	4: 43,498,913	S113P	possibly damaging	Het
Bdp1	G	A	13: 100,070,181	P618S	probably damaging	Het
Bhlhe40	C	T	6: 108,665,036	P314S	possibly damaging	Het
Birc2	A	C	9: 7,819,441	I490S	probably damaging	Het
Blm	T	C	7: 80,499,768	I698V	probably benign	Het
C87499	G	A	4: 88,630,102	S22F	probably damaging	Het
Car12	A	G	9: 66,752,406	T238A	probably damaging	Het
Cend1	G	A	7: 141,427,652	P85L	probably benign	Het
Cftr	A	T	6: 18,318,972	D1337V	probably damaging	Het
Chsy3	T	A	18: 59,176,419	M248K	probably damaging	Het
Chtf8	A	G	8: 106,885,251	F352S	probably damaging	Het
Csf2ra	T	C	19: 61,225,020	D384G	possibly damaging	Het
Ctnnbip1	T	C	4: 149,546,480	S59P	probably benign	Het
Cyth3	A	G	5: 143,707,272	N312D	probably benign	Het
Dtnb	T	C	12: 3,648,391		probably null	Het
Duox2	A	G	2: 122,289,552	S826P	possibly damaging	Het
Enthd1	C	T	15: 80,509,209	A273T	probably benign	Het
Gm13084	T	C	4: 143,810,771	N330S	probably benign	Het
Gm3138	T	C	14: 4,252,479	V159A	possibly damaging	Het
Hhip	T	C	8: 79,975,009	D632G	probably benign	Het
Igfn1	A	T	1: 135,984,218	C114S	probably benign	Het
Islr2	T	C	9: 58,197,814	D765G	probably damaging	Het
Klf14	TCCCC	TCCC	6: 30,958,541		probably null	Het
Mapk12	G	A	15: 89,131,158	P362L	probably benign	Het
Msi1	T	G	5: 115,433,870	F96V	probably damaging	Het
Mthfd1l	T	C	10: 4,103,261	V870A	probably benign	Het
Nfat5	T	C	8: 107,369,191	S1355P	possibly damaging	Het
Olfr1018	G	T	2: 85,823,880	R303M	probably benign	Het
Oplah	T	C	15: 76,297,687	N1079D	probably damaging	Het
Osbpl1a	T	A	18: 12,766,963	I645F	probably benign	Het
Pank4	T	C	4: 154,980,167	S728P	probably benign	Het
Parp2	TTGCCATAAGTGCTAAATGAAGCC	T	14: 50,810,064		probably null	Het
Piezo1	A	G	8: 122,482,118	I2503T	unknown	Het
Plekhg6	A	G	6: 125,378,805	L12P	probably damaging	Het
Plekhs1	T	A	19: 56,477,215	F204Y	probably damaging	Het
Prep	T	A	10: 45,126,063	I438N	probably benign	Het
Prss58	T	C	6: 40,897,766	H47R	probably damaging	Het
Rad51ap2	T	G	12: 11,458,277	D733E	possibly damaging	Het
Robo1	A	T	16: 72,742,161	I31F	probably damaging	Het
Setd2	A	G	9: 110,548,260	Y381C	probably damaging	Het
Slc47a2	A	G	11: 61,342,443	V87A	probably benign	Het
Slc5a9	T	C	4: 111,898,695	N2S	probably benign	Het
Spata13	A	G	14: 60,753,870	D1024G	probably damaging	Het
Stat1	T	G	1: 52,151,249	N554K	probably benign	Het
Suclg2	T	C	6: 95,595,654	D110G	possibly damaging	Het
Sult1c1	T	A	17: 53,973,889		probably null	Het
Taf5l	A	G	8: 124,003,212	I246T	probably damaging	Het
Tcof1	A	T	18: 60,843,296	D80E	probably damaging	Het
Tex33	T	A	15: 78,386,118	D150V	possibly damaging	Het
Tmem233	T	C	5: 116,082,998	Y63C	probably damaging	Het
Tshz3	A	G	7: 36,769,756	E390G	probably damaging	Het
Ttn	T	C	2: 76,730,266	T29264A	possibly damaging	Het
Ubr5	T	C	15: 38,008,775	T1065A		Het
Vcp	A	G	4: 42,985,991	V341A	probably damaging	Het
Vmn1r176	A	T	7: 23,835,323	L135*	probably null	Het
Vmn1r57	T	A	7: 5,220,500	I8N	probably damaging	Het
Ythdc2	C	T	18: 44,834,563	P209S	probably damaging	Het
Zfp213	A	T	17: 23,558,204	V288D	probably benign	Het
Zfp362	T	C	4: 128,774,526	I418V	probably damaging	Het
Zfp707	C	A	15: 75,974,746	T215K		Het
Zfp957	G	C	14: 79,212,962	R466G	probably benign	Het

Other mutations in C4b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:C4b	APN	17	34734428	missense	probably damaging	1.00
IGL00433:C4b	APN	17	34742041	missense	possibly damaging	0.75
IGL00471:C4b	APN	17	34734429	missense	probably damaging	1.00
IGL00515:C4b	APN	17	34728891	missense	probably damaging	1.00
IGL01599:C4b	APN	17	34743019	splice site	probably benign
IGL01761:C4b	APN	17	34739938	missense	possibly damaging	0.56
IGL02004:C4b	APN	17	34739010	unclassified	probably benign
IGL02215:C4b	APN	17	34734491	missense	probably damaging	1.00
IGL02517:C4b	APN	17	34734408	missense	probably benign	0.01
IGL02926:C4b	APN	17	34730712	missense	possibly damaging	0.95
IGL03031:C4b	APN	17	34731130	missense	possibly damaging	0.47
IGL03057:C4b	APN	17	34737764	unclassified	probably benign
IGL03165:C4b	APN	17	34739955	missense	probably benign	0.13
IGL03380:C4b	APN	17	34740286	missense	probably benign	0.01
Aspiration	UTSW	17	34734442	missense	probably benign	0.00
Inspiration	UTSW	17	34732166	splice site	probably null
Peroration	UTSW	17	34729399	critical splice donor site	probably null
perspiration	UTSW	17	34729831	missense	probably damaging	1.00
FR4548:C4b	UTSW	17	34740997	missense	probably benign	0.00
PIT4142001:C4b	UTSW	17	34733701	missense	probably benign	0.01
R0064:C4b	UTSW	17	34738856	missense	probably damaging	1.00
R0113:C4b	UTSW	17	34741240	missense	probably damaging	0.98
R0143:C4b	UTSW	17	34734219	unclassified	probably benign
R0254:C4b	UTSW	17	34734776	missense	probably benign	0.00
R0320:C4b	UTSW	17	34733161	missense	probably benign	0.01
R0391:C4b	UTSW	17	34735614	splice site	probably benign
R0399:C4b	UTSW	17	34728869	missense	probably damaging	1.00
R0467:C4b	UTSW	17	34736127	missense	probably benign	0.01
R0549:C4b	UTSW	17	34735415	missense	probably damaging	1.00
R0561:C4b	UTSW	17	34734417	missense	probably damaging	0.99
R0662:C4b	UTSW	17	34730888	missense	probably damaging	1.00
R0941:C4b	UTSW	17	34740055	missense	probably benign
R1161:C4b	UTSW	17	34729593	missense	probably damaging	1.00
R1169:C4b	UTSW	17	34742972	missense	probably benign	0.14
R1186:C4b	UTSW	17	34736309	missense	possibly damaging	0.47
R1310:C4b	UTSW	17	34729593	missense	probably damaging	1.00
R1398:C4b	UTSW	17	34730719	unclassified	probably benign
R1472:C4b	UTSW	17	34743769	nonsense	probably null
R1496:C4b	UTSW	17	34740021	missense	probably benign	0.30
R1544:C4b	UTSW	17	34738967	missense	probably benign	0.13
R1588:C4b	UTSW	17	34741025	missense	probably benign
R1645:C4b	UTSW	17	34740597	missense	probably damaging	1.00
R1664:C4b	UTSW	17	34732978	missense	probably damaging	1.00
R1678:C4b	UTSW	17	34743650	missense	probably benign	0.05
R1710:C4b	UTSW	17	34743664	splice site	probably benign
R1713:C4b	UTSW	17	34729271	splice site	probably benign
R1770:C4b	UTSW	17	34736927	missense	possibly damaging	0.78
R1859:C4b	UTSW	17	34735553	missense	probably benign
R1924:C4b	UTSW	17	34729657	missense	probably damaging	1.00
R2057:C4b	UTSW	17	34728620	missense	probably damaging	1.00
R2060:C4b	UTSW	17	34736101	missense	probably damaging	1.00
R2184:C4b	UTSW	17	34737702	missense	probably benign	0.27
R2306:C4b	UTSW	17	34728518	missense	probably benign	0.00
R2363:C4b	UTSW	17	34736058	splice site	probably benign
R2365:C4b	UTSW	17	34736058	splice site	probably benign
R2379:C4b	UTSW	17	34735743	missense	possibly damaging	0.81
R2860:C4b	UTSW	17	34734758	missense	probably damaging	0.99
R2861:C4b	UTSW	17	34734758	missense	probably damaging	0.99
R3551:C4b	UTSW	17	34741872	missense	possibly damaging	0.75
R3765:C4b	UTSW	17	34729840	missense	probably damaging	0.98
R4157:C4b	UTSW	17	34742855	missense	probably damaging	1.00
R4299:C4b	UTSW	17	34731144	missense	possibly damaging	0.52
R4365:C4b	UTSW	17	34734743	missense	possibly damaging	0.65
R4411:C4b	UTSW	17	34728864	missense	probably damaging	1.00
R4613:C4b	UTSW	17	34734551	missense	probably benign	0.12
R4784:C4b	UTSW	17	34733406	missense	probably benign	0.00
R4790:C4b	UTSW	17	34734143	missense	probably benign	0.01
R4831:C4b	UTSW	17	34736890	splice site	probably null
R4879:C4b	UTSW	17	34743647	missense	probably damaging	0.99
R5036:C4b	UTSW	17	34740445	critical splice acceptor site	probably null
R5361:C4b	UTSW	17	34741238	missense	probably benign	0.15
R5384:C4b	UTSW	17	34737661	missense	possibly damaging	0.89
R5518:C4b	UTSW	17	34734442	missense	probably benign	0.00
R5590:C4b	UTSW	17	34740335	missense	probably damaging	0.98
R5643:C4b	UTSW	17	34742417	missense	probably benign	0.01
R5644:C4b	UTSW	17	34742417	missense	probably benign	0.01
R5833:C4b	UTSW	17	34730673	missense	probably damaging	1.00
R5931:C4b	UTSW	17	34729193	missense	probably damaging	0.99
R6178:C4b	UTSW	17	34733406	missense	probably benign	0.00
R6209:C4b	UTSW	17	34741087	missense	possibly damaging	0.93
R6225:C4b	UTSW	17	34738874	missense	possibly damaging	0.64
R6518:C4b	UTSW	17	34734205	missense	probably damaging	0.98
R6613:C4b	UTSW	17	34733565	missense	probably damaging	0.99
R6781:C4b	UTSW	17	34742954	missense	probably damaging	0.99
R6807:C4b	UTSW	17	34730956	missense	probably benign	0.17
R6858:C4b	UTSW	17	34729831	missense	probably damaging	1.00
R6962:C4b	UTSW	17	34732166	splice site	probably null
R7068:C4b	UTSW	17	34733477	missense	probably damaging	1.00
R7081:C4b	UTSW	17	34735443	missense	probably benign	0.27
R7211:C4b	UTSW	17	34735534	missense	possibly damaging	0.92
R7296:C4b	UTSW	17	34743659	missense	probably damaging	1.00
R7314:C4b	UTSW	17	34740356	missense	probably benign
R7330:C4b	UTSW	17	34730472	missense	probably damaging	1.00
R7397:C4b	UTSW	17	34742390	missense	possibly damaging	0.80
R7437:C4b	UTSW	17	34734733	missense	probably benign	0.10
R7490:C4b	UTSW	17	34731080	nonsense	probably null
R7597:C4b	UTSW	17	34739675	missense	probably benign
R7633:C4b	UTSW	17	34729399	critical splice donor site	probably null
R7900:C4b	UTSW	17	34739777	missense	probably benign	0.03
R7910:C4b	UTSW	17	34740352	missense	probably benign	0.00
R7923:C4b	UTSW	17	34742380	missense	probably damaging	1.00
R7960:C4b	UTSW	17	34741278	splice site	probably null
R8420:C4b	UTSW	17	34734539	missense	probably damaging	0.97
R8467:C4b	UTSW	17	34732813	missense	possibly damaging	0.51
R8558:C4b	UTSW	17	34736567	missense	probably damaging	1.00
R8725:C4b	UTSW	17	34734485	missense	probably damaging	1.00
R8727:C4b	UTSW	17	34734485	missense	probably damaging	1.00
R8853:C4b	UTSW	17	34729905	missense	possibly damaging	0.91
R8934:C4b	UTSW	17	34732984	missense	possibly damaging	0.78
R8944:C4b	UTSW	17	34742939	missense	probably benign	0.00
R8960:C4b	UTSW	17	34733918	missense	probably damaging	1.00
R8982:C4b	UTSW	17	34734364	critical splice donor site	probably null
R9104:C4b	UTSW	17	34729259	missense	probably benign	0.39
R9114:C4b	UTSW	17	34729430	missense	probably damaging	0.99
R9348:C4b	UTSW	17	34733185	missense	probably benign	0.01
R9428:C4b	UTSW	17	34730911	missense	possibly damaging	0.52
R9533:C4b	UTSW	17	34737724	nonsense	probably null
R9591:C4b	UTSW	17	34738955	missense	probably benign	0.00
R9678:C4b	UTSW	17	34741789	critical splice donor site	probably null
Z1176:C4b	UTSW	17	34731147	missense	probably damaging	0.97

Predicted Primers

Posted On

2019-05-15