Incidental Mutation 'R7105:C4b'
ID551144
Institutional Source Beutler Lab
Gene Symbol C4b
Ensembl Gene ENSMUSG00000073418
Gene Namecomplement component 4B (Chido blood group)
SynonymsC4, Ss
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7105 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location34728380-34743882 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 34730911 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 1433 (T1433M)
Ref Sequence ENSEMBL: ENSMUSP00000069418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069507]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069507
AA Change: T1433M

PolyPhen 2 Score 0.516 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000069418
Gene: ENSMUSG00000073418
AA Change: T1433M

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:A2M_N 138 231 2e-19 PFAM
A2M_N_2 470 609 2.87e-26 SMART
ANATO 700 734 3.58e-12 SMART
low complexity region 761 771 N/A INTRINSIC
A2M 779 867 1.46e-27 SMART
Pfam:Thiol-ester_cl 995 1024 7.7e-13 PFAM
Pfam:A2M_comp 1047 1313 1.3e-82 PFAM
low complexity region 1441 1447 N/A INTRINSIC
A2M_recep 1475 1564 1.03e-36 SMART
C345C 1608 1720 5.69e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173057
SMART Domains Protein: ENSMUSP00000134611
Gene: ENSMUSG00000073418

DomainStartEndE-ValueType
Pfam:A2M 1 62 6.5e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (65/68)
MGI Phenotype PHENOTYPE: Homozygous C4 deficient mice have compromised immune responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,397,842 I3565N probably damaging Het
Adam8 T C 7: 139,990,055 E99G probably benign Het
Adnp2 A C 18: 80,128,151 H1014Q possibly damaging Het
Agbl4 T A 4: 111,566,723 N315K probably benign Het
Ankrd33b G T 15: 31,305,068 N183K probably damaging Het
Arhgef39 A G 4: 43,498,913 S113P possibly damaging Het
Bdp1 G A 13: 100,070,181 P618S probably damaging Het
Bhlhe40 C T 6: 108,665,036 P314S possibly damaging Het
Birc2 A C 9: 7,819,441 I490S probably damaging Het
Blm T C 7: 80,499,768 I698V probably benign Het
C87499 G A 4: 88,630,102 S22F probably damaging Het
Car12 A G 9: 66,752,406 T238A probably damaging Het
Cend1 G A 7: 141,427,652 P85L probably benign Het
Cftr A T 6: 18,318,972 D1337V probably damaging Het
Chsy3 T A 18: 59,176,419 M248K probably damaging Het
Chtf8 A G 8: 106,885,251 F352S probably damaging Het
Csf2ra T C 19: 61,225,020 D384G possibly damaging Het
Ctnnbip1 T C 4: 149,546,480 S59P probably benign Het
Cyth3 A G 5: 143,707,272 N312D probably benign Het
Dtnb T C 12: 3,648,391 probably null Het
Duox2 A G 2: 122,289,552 S826P possibly damaging Het
Enthd1 C T 15: 80,509,209 A273T probably benign Het
Gm13084 T C 4: 143,810,771 N330S probably benign Het
Gm3138 T C 14: 4,252,479 V159A possibly damaging Het
Hhip T C 8: 79,975,009 D632G probably benign Het
Igfn1 A T 1: 135,984,218 C114S probably benign Het
Islr2 T C 9: 58,197,814 D765G probably damaging Het
Klf14 TCCCC TCCC 6: 30,958,541 probably null Het
Mapk12 G A 15: 89,131,158 P362L probably benign Het
Msi1 T G 5: 115,433,870 F96V probably damaging Het
Mthfd1l T C 10: 4,103,261 V870A probably benign Het
Nfat5 T C 8: 107,369,191 S1355P possibly damaging Het
Olfr1018 G T 2: 85,823,880 R303M probably benign Het
Oplah T C 15: 76,297,687 N1079D probably damaging Het
Osbpl1a T A 18: 12,766,963 I645F probably benign Het
Pank4 T C 4: 154,980,167 S728P probably benign Het
Parp2 TTGCCATAAGTGCTAAATGAAGCC T 14: 50,810,064 probably null Het
Piezo1 A G 8: 122,482,118 I2503T unknown Het
Plekhg6 A G 6: 125,378,805 L12P probably damaging Het
Plekhs1 T A 19: 56,477,215 F204Y probably damaging Het
Prep T A 10: 45,126,063 I438N probably benign Het
Prss58 T C 6: 40,897,766 H47R probably damaging Het
Rad51ap2 T G 12: 11,458,277 D733E possibly damaging Het
Robo1 A T 16: 72,742,161 I31F probably damaging Het
Setd2 A G 9: 110,548,260 Y381C probably damaging Het
Slc47a2 A G 11: 61,342,443 V87A probably benign Het
Slc5a9 T C 4: 111,898,695 N2S probably benign Het
Spata13 A G 14: 60,753,870 D1024G probably damaging Het
Stat1 T G 1: 52,151,249 N554K probably benign Het
Suclg2 T C 6: 95,595,654 D110G possibly damaging Het
Sult1c1 T A 17: 53,973,889 probably null Het
Taf5l A G 8: 124,003,212 I246T probably damaging Het
Tcof1 A T 18: 60,843,296 D80E probably damaging Het
Tex33 T A 15: 78,386,118 D150V possibly damaging Het
Tmem233 T C 5: 116,082,998 Y63C probably damaging Het
Tshz3 A G 7: 36,769,756 E390G probably damaging Het
Ttn T C 2: 76,730,266 T29264A possibly damaging Het
Ubr5 T C 15: 38,008,775 T1065A Het
Vcp A G 4: 42,985,991 V341A probably damaging Het
Vmn1r176 A T 7: 23,835,323 L135* probably null Het
Vmn1r57 T A 7: 5,220,500 I8N probably damaging Het
Ythdc2 C T 18: 44,834,563 P209S probably damaging Het
Zfp213 A T 17: 23,558,204 V288D probably benign Het
Zfp362 T C 4: 128,774,526 I418V probably damaging Het
Zfp707 C A 15: 75,974,746 T215K Het
Zfp957 G C 14: 79,212,962 R466G probably benign Het
Other mutations in C4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:C4b APN 17 34734428 missense probably damaging 1.00
IGL00433:C4b APN 17 34742041 missense possibly damaging 0.75
IGL00471:C4b APN 17 34734429 missense probably damaging 1.00
IGL00515:C4b APN 17 34728891 missense probably damaging 1.00
IGL01599:C4b APN 17 34743019 splice site probably benign
IGL01761:C4b APN 17 34739938 missense possibly damaging 0.56
IGL02004:C4b APN 17 34739010 unclassified probably benign
IGL02215:C4b APN 17 34734491 missense probably damaging 1.00
IGL02517:C4b APN 17 34734408 missense probably benign 0.01
IGL02926:C4b APN 17 34730712 missense possibly damaging 0.95
IGL03031:C4b APN 17 34731130 missense possibly damaging 0.47
IGL03057:C4b APN 17 34737764 unclassified probably benign
IGL03165:C4b APN 17 34739955 missense probably benign 0.13
IGL03380:C4b APN 17 34740286 missense probably benign 0.01
Aspiration UTSW 17 34734442 missense probably benign 0.00
Inspiration UTSW 17 34732166 splice site probably null
Peroration UTSW 17 34729399 critical splice donor site probably null
perspiration UTSW 17 34729831 missense probably damaging 1.00
FR4548:C4b UTSW 17 34740997 missense probably benign 0.00
PIT4142001:C4b UTSW 17 34733701 missense probably benign 0.01
R0064:C4b UTSW 17 34738856 missense probably damaging 1.00
R0113:C4b UTSW 17 34741240 missense probably damaging 0.98
R0143:C4b UTSW 17 34734219 unclassified probably benign
R0254:C4b UTSW 17 34734776 missense probably benign 0.00
R0320:C4b UTSW 17 34733161 missense probably benign 0.01
R0391:C4b UTSW 17 34735614 splice site probably benign
R0399:C4b UTSW 17 34728869 missense probably damaging 1.00
R0467:C4b UTSW 17 34736127 missense probably benign 0.01
R0549:C4b UTSW 17 34735415 missense probably damaging 1.00
R0561:C4b UTSW 17 34734417 missense probably damaging 0.99
R0662:C4b UTSW 17 34730888 missense probably damaging 1.00
R0941:C4b UTSW 17 34740055 missense probably benign
R1161:C4b UTSW 17 34729593 missense probably damaging 1.00
R1169:C4b UTSW 17 34742972 missense probably benign 0.14
R1186:C4b UTSW 17 34736309 missense possibly damaging 0.47
R1310:C4b UTSW 17 34729593 missense probably damaging 1.00
R1398:C4b UTSW 17 34730719 unclassified probably benign
R1472:C4b UTSW 17 34743769 nonsense probably null
R1496:C4b UTSW 17 34740021 missense probably benign 0.30
R1544:C4b UTSW 17 34738967 missense probably benign 0.13
R1588:C4b UTSW 17 34741025 missense probably benign
R1645:C4b UTSW 17 34740597 missense probably damaging 1.00
R1664:C4b UTSW 17 34732978 missense probably damaging 1.00
R1678:C4b UTSW 17 34743650 missense probably benign 0.05
R1710:C4b UTSW 17 34743664 splice site probably benign
R1713:C4b UTSW 17 34729271 splice site probably benign
R1770:C4b UTSW 17 34736927 missense possibly damaging 0.78
R1859:C4b UTSW 17 34735553 missense probably benign
R1924:C4b UTSW 17 34729657 missense probably damaging 1.00
R2057:C4b UTSW 17 34728620 missense probably damaging 1.00
R2060:C4b UTSW 17 34736101 missense probably damaging 1.00
R2184:C4b UTSW 17 34737702 missense probably benign 0.27
R2306:C4b UTSW 17 34728518 missense probably benign 0.00
R2363:C4b UTSW 17 34736058 splice site probably benign
R2365:C4b UTSW 17 34736058 splice site probably benign
R2379:C4b UTSW 17 34735743 missense possibly damaging 0.81
R2860:C4b UTSW 17 34734758 missense probably damaging 0.99
R2861:C4b UTSW 17 34734758 missense probably damaging 0.99
R3551:C4b UTSW 17 34741872 missense possibly damaging 0.75
R3765:C4b UTSW 17 34729840 missense probably damaging 0.98
R4157:C4b UTSW 17 34742855 missense probably damaging 1.00
R4299:C4b UTSW 17 34731144 missense possibly damaging 0.52
R4365:C4b UTSW 17 34734743 missense possibly damaging 0.65
R4411:C4b UTSW 17 34728864 missense probably damaging 1.00
R4613:C4b UTSW 17 34734551 missense probably benign 0.12
R4784:C4b UTSW 17 34733406 missense probably benign 0.00
R4790:C4b UTSW 17 34734143 missense probably benign 0.01
R4831:C4b UTSW 17 34736890 splice site probably null
R4879:C4b UTSW 17 34743647 missense probably damaging 0.99
R5036:C4b UTSW 17 34740445 critical splice acceptor site probably null
R5361:C4b UTSW 17 34741238 missense probably benign 0.15
R5384:C4b UTSW 17 34737661 missense possibly damaging 0.89
R5518:C4b UTSW 17 34734442 missense probably benign 0.00
R5590:C4b UTSW 17 34740335 missense probably damaging 0.98
R5643:C4b UTSW 17 34742417 missense probably benign 0.01
R5644:C4b UTSW 17 34742417 missense probably benign 0.01
R5833:C4b UTSW 17 34730673 missense probably damaging 1.00
R5931:C4b UTSW 17 34729193 missense probably damaging 0.99
R6178:C4b UTSW 17 34733406 missense probably benign 0.00
R6209:C4b UTSW 17 34741087 missense possibly damaging 0.93
R6225:C4b UTSW 17 34738874 missense possibly damaging 0.64
R6518:C4b UTSW 17 34734205 missense probably damaging 0.98
R6613:C4b UTSW 17 34733565 missense probably damaging 0.99
R6781:C4b UTSW 17 34742954 missense probably damaging 0.99
R6807:C4b UTSW 17 34730956 missense probably benign 0.17
R6858:C4b UTSW 17 34729831 missense probably damaging 1.00
R6962:C4b UTSW 17 34732166 splice site probably null
R7068:C4b UTSW 17 34733477 missense probably damaging 1.00
R7081:C4b UTSW 17 34735443 missense probably benign 0.27
R7211:C4b UTSW 17 34735534 missense possibly damaging 0.92
R7296:C4b UTSW 17 34743659 missense probably damaging 1.00
R7314:C4b UTSW 17 34740356 missense probably benign
R7330:C4b UTSW 17 34730472 missense probably damaging 1.00
R7397:C4b UTSW 17 34742390 missense possibly damaging 0.80
R7437:C4b UTSW 17 34734733 missense probably benign 0.10
R7490:C4b UTSW 17 34731080 nonsense probably null
R7597:C4b UTSW 17 34739675 missense probably benign
R7633:C4b UTSW 17 34729399 critical splice donor site probably null
R7900:C4b UTSW 17 34739777 missense probably benign 0.03
R7910:C4b UTSW 17 34740352 missense probably benign 0.00
R7923:C4b UTSW 17 34742380 missense probably damaging 1.00
Z1176:C4b UTSW 17 34731147 missense probably damaging 0.97
Predicted Primers
Posted On2019-05-15