Incidental Mutation 'R7106:Map2'
ID551153
Institutional Source Beutler Lab
Gene Symbol Map2
Ensembl Gene ENSMUSG00000015222
Gene Namemicrotubule-associated protein 2
Synonymsrepro4, MAP-2, Mtap2, G1-397-34
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.781) question?
Stock #R7106 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location66175273-66442583 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 66410744 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 209 (A209T)
Ref Sequence ENSEMBL: ENSMUSP00000134471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024639] [ENSMUST00000077355] [ENSMUST00000114012] [ENSMUST00000114013] [ENSMUST00000114015] [ENSMUST00000114017] [ENSMUST00000114018] [ENSMUST00000145419] [ENSMUST00000173855]
Predicted Effect probably benign
Transcript: ENSMUST00000024639
SMART Domains Protein: ENSMUSP00000024639
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.1e-18 PFAM
Pfam:Tubulin-binding 332 362 9.1e-20 PFAM
Pfam:Tubulin-binding 363 394 1.7e-17 PFAM
low complexity region 422 435 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077355
SMART Domains Protein: ENSMUSP00000076577
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.1e-18 PFAM
Pfam:Tubulin-binding 332 362 9.1e-20 PFAM
Pfam:Tubulin-binding 363 394 1.7e-17 PFAM
low complexity region 422 435 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114012
SMART Domains Protein: ENSMUSP00000109645
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 133 140 N/A INTRINSIC
low complexity region 181 195 N/A INTRINSIC
low complexity region 205 221 N/A INTRINSIC
low complexity region 228 250 N/A INTRINSIC
Pfam:Tubulin-binding 299 330 2.1e-18 PFAM
Pfam:Tubulin-binding 331 361 9.1e-20 PFAM
Pfam:Tubulin-binding 362 393 1.7e-17 PFAM
low complexity region 421 434 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114013
SMART Domains Protein: ENSMUSP00000109646
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
Pfam:RII_binding_1 86 103 1.2e-5 PFAM
low complexity region 120 141 N/A INTRINSIC
Pfam:MAP2_projctn 376 1510 N/A PFAM
low complexity region 1543 1557 N/A INTRINSIC
low complexity region 1567 1583 N/A INTRINSIC
low complexity region 1590 1612 N/A INTRINSIC
Pfam:Tubulin-binding 1662 1692 1.7e-13 PFAM
Pfam:Tubulin-binding 1693 1723 5.8e-18 PFAM
Pfam:Tubulin-binding 1724 1755 5.9e-18 PFAM
low complexity region 1783 1796 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114015
SMART Domains Protein: ENSMUSP00000109648
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.1e-18 PFAM
Pfam:Tubulin-binding 332 362 9.1e-20 PFAM
Pfam:Tubulin-binding 363 394 1.7e-17 PFAM
low complexity region 422 435 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114017
SMART Domains Protein: ENSMUSP00000109650
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.3e-18 PFAM
Pfam:Tubulin-binding 332 362 2.3e-19 PFAM
Pfam:Tubulin-binding 363 393 9.9e-20 PFAM
Pfam:Tubulin-binding 394 425 1.9e-17 PFAM
low complexity region 453 466 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114018
SMART Domains Protein: ENSMUSP00000109651
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.3e-18 PFAM
Pfam:Tubulin-binding 332 362 2.3e-19 PFAM
Pfam:Tubulin-binding 363 393 9.9e-20 PFAM
Pfam:Tubulin-binding 394 425 1.9e-17 PFAM
low complexity region 453 466 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141148
SMART Domains Protein: ENSMUSP00000117996
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
Pfam:RII_binding_1 23 40 3.2e-6 PFAM
low complexity region 70 77 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145419
SMART Domains Protein: ENSMUSP00000134538
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
Pfam:MAP2_projctn 218 608 1.7e-250 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000173855
AA Change: A209T

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134471
Gene: ENSMUSG00000015222
AA Change: A209T

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 142 163 N/A INTRINSIC
Pfam:MAP2_projctn 458 565 1.1e-52 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The products of similar genes in rat and mouse are neuron-specific cytoskeletal proteins that are enriched in dentrites, implicating a role in determining and stabilizing dentritic shape during neuron development. A number of alternatively spliced variants encoding distinct isoforms have been described. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered contextual memory. Mice homozygous for another knock-out allele display decreased body weight, altered microtubule density and organization in Purkinje cell dendrites, and reduced dendritic length inhippocampal neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldob T C 4: 49,541,258 Y138C probably damaging Het
Ano7 A C 1: 93,374,983 probably null Het
Arvcf T A 16: 18,399,049 V497E probably damaging Het
Atad2 A G 15: 58,116,766 probably null Het
Brinp1 C T 4: 68,829,378 A163T probably benign Het
Catsperd C A 17: 56,658,070 probably null Het
Ccm2l A G 2: 153,070,651 H70R possibly damaging Het
Cgnl1 G A 9: 71,725,733 T112I probably benign Het
Chid1 T C 7: 141,522,660 H220R probably benign Het
Clca1 A G 3: 145,027,429 V106A probably damaging Het
Cldn23 A C 8: 35,825,915 S140A probably benign Het
Dennd2c T C 3: 103,131,577 S14P possibly damaging Het
Det1 T C 7: 78,843,464 D264G probably damaging Het
Dmwd T C 7: 19,080,529 V368A probably damaging Het
Dnah11 T C 12: 117,961,149 K3362E probably benign Het
Dnah8 T C 17: 30,741,178 F2208L probably damaging Het
Dnaja3 T C 16: 4,705,934 I477T probably benign Het
Dnmt3a A G 12: 3,897,591 K482E probably damaging Het
Dock7 A G 4: 98,967,326 I1493T unknown Het
Ehbp1l1 A G 19: 5,718,737 V846A probably benign Het
Fbxl4 T A 4: 22,427,140 probably null Het
Fgd2 T A 17: 29,376,970 L534* probably null Het
Fgfr3 T C 5: 33,731,414 V349A probably damaging Het
Gal3st1 A T 11: 3,998,509 I239F probably damaging Het
Gpatch3 C A 4: 133,578,203 H250N probably benign Het
Guca1b A T 17: 47,391,311 K230* probably null Het
Itga3 G T 11: 95,055,873 L737I probably benign Het
Kmt5c A G 7: 4,742,706 K122E probably damaging Het
Kpna4 G A 3: 69,079,464 Q531* probably null Het
Lctl A G 9: 64,132,837 E410G probably benign Het
Lhx1 T C 11: 84,522,077 N128D probably benign Het
Lifr A G 15: 7,172,924 N349D probably benign Het
Mif4gd G A 11: 115,611,911 A25V probably damaging Het
Mug2 T C 6: 122,082,721 S1353P probably damaging Het
Myh9 A G 15: 77,775,121 C931R probably benign Het
Nelfe T G 17: 34,852,419 probably null Het
Nrf1 A G 6: 30,102,184 S161G probably benign Het
Pik3c2a G A 7: 116,418,133 Q130* probably null Het
Prex2 T A 1: 11,136,793 M525K probably benign Het
Psme2 A G 14: 55,588,237 S165P probably benign Het
Rapgef2 A G 3: 79,066,608 F1477S probably benign Het
Rasef A T 4: 73,727,627 C502S probably damaging Het
Rpap2 T A 5: 107,633,122 L565* probably null Het
Sav1 A G 12: 69,984,616 I44T probably damaging Het
Selp T A 1: 164,126,422 I97N probably benign Het
Serpina1d A G 12: 103,765,721 F293S probably benign Het
Sin3b T C 8: 72,724,137 F65L possibly damaging Het
Sorcs3 G C 19: 48,705,963 G559R probably damaging Het
Susd2 A T 10: 75,638,053 D689E probably damaging Het
Tas1r2 A T 4: 139,662,049 M448L probably benign Het
Tbc1d30 A T 10: 121,301,992 I181N possibly damaging Het
Tcea3 A G 4: 136,271,368 T318A probably damaging Het
Tomm70a T C 16: 57,140,758 V358A probably damaging Het
Tpp1 A C 7: 105,749,911 S153A possibly damaging Het
Trip13 C T 13: 73,914,532 V387I probably benign Het
Ttn T C 2: 76,797,488 I14704V probably benign Het
Uimc1 C A 13: 55,050,815 C516F possibly damaging Het
Vit A G 17: 78,586,799 N210S probably benign Het
Vmn1r22 G T 6: 57,900,311 T227K probably damaging Het
Vmn2r5 A G 3: 64,491,683 I625T probably benign Het
Zfp27 AATCCGCTTGTGCA AA 7: 29,895,021 probably benign Het
Zfp384 T C 6: 125,024,259 L98P probably benign Het
Zfp809 G T 9: 22,236,224 K51N probably benign Het
Other mutations in Map2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01518:Map2 APN 1 66425331 missense probably damaging 1.00
IGL02135:Map2 APN 1 66380761 nonsense probably null
IGL02526:Map2 APN 1 66380717 missense possibly damaging 0.94
Annas UTSW 1 66433597 critical splice donor site probably null
calliope UTSW 1 66425298 missense probably damaging 1.00
costas UTSW 1 66412653 missense possibly damaging 0.94
Jacobin UTSW 1 66399419 missense probably damaging 1.00
ruby_throat UTSW 1 66414884 missense possibly damaging 0.67
Rufous UTSW 1 66380768 missense probably damaging 1.00
Speckled UTSW 1 66412727 nonsense probably null
Sunbird UTSW 1 66415487 missense probably benign 0.01
E0370:Map2 UTSW 1 66416724 unclassified probably benign
PIT4362001:Map2 UTSW 1 66412518 missense probably benign 0.05
R0067:Map2 UTSW 1 66413163 missense probably benign 0.04
R0238:Map2 UTSW 1 66416106 missense probably damaging 1.00
R0238:Map2 UTSW 1 66416106 missense probably damaging 1.00
R0239:Map2 UTSW 1 66416106 missense probably damaging 1.00
R0239:Map2 UTSW 1 66416106 missense probably damaging 1.00
R0268:Map2 UTSW 1 66380722 nonsense probably null
R0302:Map2 UTSW 1 66414828 missense probably benign 0.15
R0305:Map2 UTSW 1 66413094 missense probably benign 0.00
R0409:Map2 UTSW 1 66433580 missense probably damaging 1.00
R0561:Map2 UTSW 1 66425497 missense probably damaging 1.00
R0674:Map2 UTSW 1 66413202 missense probably damaging 1.00
R0738:Map2 UTSW 1 66425189 splice site probably benign
R0893:Map2 UTSW 1 66380768 missense probably damaging 1.00
R1305:Map2 UTSW 1 66425395 missense probably damaging 1.00
R1534:Map2 UTSW 1 66413180 missense probably benign 0.33
R1632:Map2 UTSW 1 66415086 missense possibly damaging 0.60
R1682:Map2 UTSW 1 66415622 unclassified probably null
R1774:Map2 UTSW 1 66414074 missense probably damaging 1.00
R2014:Map2 UTSW 1 66416136 missense possibly damaging 0.55
R2017:Map2 UTSW 1 66412799 missense probably damaging 1.00
R2050:Map2 UTSW 1 66414314 missense probably damaging 0.98
R2093:Map2 UTSW 1 66399440 missense probably damaging 1.00
R2214:Map2 UTSW 1 66420186 missense probably damaging 0.99
R2284:Map2 UTSW 1 66414068 missense probably damaging 1.00
R3011:Map2 UTSW 1 66414612 missense probably damaging 1.00
R3105:Map2 UTSW 1 66433597 critical splice donor site probably null
R3708:Map2 UTSW 1 66416555 unclassified probably benign
R3709:Map2 UTSW 1 66415856 nonsense probably null
R3729:Map2 UTSW 1 66412446 missense possibly damaging 0.80
R3760:Map2 UTSW 1 66438918 missense probably damaging 1.00
R3788:Map2 UTSW 1 66416863 missense probably damaging 0.99
R3789:Map2 UTSW 1 66416863 missense probably damaging 0.99
R4003:Map2 UTSW 1 66415740 missense probably damaging 1.00
R4120:Map2 UTSW 1 66415904 missense probably damaging 1.00
R4172:Map2 UTSW 1 66413600 missense possibly damaging 0.89
R4198:Map2 UTSW 1 66425298 missense probably damaging 1.00
R4200:Map2 UTSW 1 66425298 missense probably damaging 1.00
R4205:Map2 UTSW 1 66425290 missense probably damaging 1.00
R4613:Map2 UTSW 1 66425469 missense probably damaging 1.00
R4700:Map2 UTSW 1 66410637 missense probably damaging 0.96
R4974:Map2 UTSW 1 66413505 missense probably benign 0.15
R5007:Map2 UTSW 1 66413289 missense possibly damaging 0.86
R5039:Map2 UTSW 1 66438796 missense probably damaging 1.00
R5237:Map2 UTSW 1 66439010 unclassified probably benign
R5313:Map2 UTSW 1 66425379 missense probably damaging 1.00
R5455:Map2 UTSW 1 66399391 missense probably damaging 1.00
R5490:Map2 UTSW 1 66413133 missense probably damaging 1.00
R5517:Map2 UTSW 1 66415256 missense probably benign 0.00
R5532:Map2 UTSW 1 66414620 missense probably damaging 1.00
R5583:Map2 UTSW 1 66416037 missense probably damaging 1.00
R5764:Map2 UTSW 1 66414875 missense probably damaging 0.99
R5996:Map2 UTSW 1 66414884 missense possibly damaging 0.67
R6058:Map2 UTSW 1 66415414 missense probably benign 0.05
R6199:Map2 UTSW 1 66425478 missense probably damaging 1.00
R6208:Map2 UTSW 1 66431590 missense probably damaging 1.00
R6276:Map2 UTSW 1 66399419 missense probably damaging 1.00
R6378:Map2 UTSW 1 66415329 missense probably damaging 1.00
R6424:Map2 UTSW 1 66414787 missense possibly damaging 0.67
R6743:Map2 UTSW 1 66415607 missense probably benign 0.04
R6837:Map2 UTSW 1 66414572 missense probably damaging 1.00
R6901:Map2 UTSW 1 66421773 missense possibly damaging 0.94
R6984:Map2 UTSW 1 66415236 missense possibly damaging 0.90
R6989:Map2 UTSW 1 66414906 missense probably benign 0.00
R7001:Map2 UTSW 1 66415487 missense probably benign 0.01
R7055:Map2 UTSW 1 66416824 missense probably damaging 1.00
R7094:Map2 UTSW 1 66412727 nonsense probably null
R7182:Map2 UTSW 1 66412653 missense possibly damaging 0.94
R7235:Map2 UTSW 1 66414648 missense probably damaging 1.00
R7424:Map2 UTSW 1 66414824 missense possibly damaging 0.69
R7473:Map2 UTSW 1 66415458 missense probably damaging 1.00
R7642:Map2 UTSW 1 66413307 missense probably benign 0.01
R7660:Map2 UTSW 1 66414377 missense probably damaging 1.00
R7673:Map2 UTSW 1 66413774 missense probably benign 0.03
R7768:Map2 UTSW 1 66414483 missense possibly damaging 0.94
R7834:Map2 UTSW 1 66416488 missense probably damaging 1.00
R7842:Map2 UTSW 1 66416411 missense probably benign
R7917:Map2 UTSW 1 66416488 missense probably damaging 1.00
R7925:Map2 UTSW 1 66416411 missense probably benign
R8056:Map2 UTSW 1 66415620 missense probably damaging 0.99
V8831:Map2 UTSW 1 66415845 missense probably damaging 1.00
Z1177:Map2 UTSW 1 66380680 missense probably benign 0.01
Z1177:Map2 UTSW 1 66438361 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GTTCTGTGGTCATGATGTCAAC -3'
(R):5'- CGAAGCCTGAAATGGTGGTC -3'

Sequencing Primer
(F):5'- TCTTTTTCATCCCCCAAGAAGAAG -3'
(R):5'- GTCTTATGATCATGAGAAGACCCAGC -3'
Posted On2019-05-15