Incidental Mutation 'R0597:Il5ra'
ID55116
Institutional Source Beutler Lab
Gene Symbol Il5ra
Ensembl Gene ENSMUSG00000005364
Gene Nameinterleukin 5 receptor, alpha
SynonymsCDw125, IL-5 receptor alpha chain, CD125, Il5r
MMRRC Submission 038786-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R0597 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location106710357-106749037 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to G at 106744335 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 1 (M1T)
Ref Sequence ENSEMBL: ENSMUSP00000144718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167925] [ENSMUST00000204659] [ENSMUST00000205004]
Predicted Effect probably null
Transcript: ENSMUST00000167925
AA Change: M1T

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000129781
Gene: ENSMUSG00000005364
AA Change: M1T

DomainStartEndE-ValueType
FN3 27 159 6.27e0 SMART
FN3 236 312 1.28e1 SMART
transmembrane domain 335 357 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000204659
AA Change: M1T

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144718
Gene: ENSMUSG00000005364
AA Change: M1T

DomainStartEndE-ValueType
FN3 27 159 6.27e0 SMART
FN3 236 312 1.28e1 SMART
transmembrane domain 335 357 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205004
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 99.0%
  • 10x: 97.4%
  • 20x: 94.1%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an interleukin 5 specific subunit of a heterodimeric cytokine receptor. The receptor is comprised of a ligand specific alpha subunit and a signal transducing beta subunit shared by the receptors for interleukin 3 (IL3), colony stimulating factor 2 (CSF2/GM-CSF), and interleukin 5 (IL5). The binding of this protein to IL5 depends on the beta subunit. The beta subunit is activated by the ligand binding, and is required for the biological activities of IL5. This protein has been found to interact with syndecan binding protein (syntenin), which is required for IL5 mediated activation of the transcription factor SOX4. Several alternatively spliced transcript variants encoding four distinct isoforms have been reported. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display a generally normal phenotype but with some immune system deficiencies. Mice homozygous for one knock-out allele exhibit increased metastasis of injected B16F10 melanoma cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy10 T C 1: 165,525,062 probably null Het
Anxa11 T C 14: 25,874,228 I221T probably damaging Het
Arhgap33 C G 7: 30,526,446 R565P probably damaging Het
Bmpr2 T C 1: 59,841,425 probably benign Het
Btn2a2 T A 13: 23,486,410 H51L probably benign Het
Casz1 T C 4: 148,944,394 S1099P probably benign Het
Cnot4 A G 6: 35,051,503 S393P possibly damaging Het
Cntnap5a T C 1: 116,184,461 probably benign Het
Cobl T C 11: 12,254,699 T586A probably benign Het
Crocc A G 4: 141,017,071 L1838P probably benign Het
Crocc T C 4: 141,019,913 K1528R probably benign Het
Dact2 A G 17: 14,197,041 V299A probably benign Het
Dapk1 C A 13: 60,761,384 N1270K probably benign Het
Ddx41 T C 13: 55,533,006 Y375C probably damaging Het
Dock5 T A 14: 67,784,934 probably null Het
Dyrk4 T G 6: 126,886,649 probably null Het
Eno1b T C 18: 48,047,739 I328T probably benign Het
Fam210b A G 2: 172,345,853 probably benign Het
Fbxl13 A G 5: 21,614,714 I229T probably benign Het
Fbxo39 A G 11: 72,316,921 D33G probably damaging Het
Fbxw11 A G 11: 32,720,496 E120G probably damaging Het
Fbxw2 A T 2: 34,811,020 L261Q probably damaging Het
Gm13084 G T 4: 143,812,652 N90K probably damaging Het
Gm5800 A C 14: 51,716,004 N51K probably benign Het
Gm6899 A G 11: 26,593,768 probably benign Het
Gm9745 C A 13: 8,940,766 probably benign Het
Gpx8 T C 13: 113,045,501 T133A possibly damaging Het
Grin3a C T 4: 49,665,351 V1095M probably damaging Het
Grip2 T C 6: 91,796,197 probably benign Het
Hacd4 A G 4: 88,437,520 F43L probably damaging Het
Hif1a T G 12: 73,942,275 S645R probably benign Het
Hipk3 A G 2: 104,433,637 S839P possibly damaging Het
Il16 A T 7: 83,677,975 probably benign Het
Il3ra T A 14: 14,351,166 probably null Het
Klra2 G A 6: 131,220,185 R251C probably benign Het
Lamc2 C T 1: 153,133,621 V813M probably benign Het
Lbr A G 1: 181,832,213 V139A probably benign Het
Lrp5 T C 19: 3,600,777 D1219G possibly damaging Het
Map3k6 C T 4: 133,245,552 P341S possibly damaging Het
Mcts2 A G 2: 152,687,689 E140G probably benign Het
Med1 T C 11: 98,169,438 M222V probably benign Het
Mef2a G T 7: 67,235,148 S406* probably null Het
Muc19 A T 15: 91,900,502 noncoding transcript Het
Nr1h2 A G 7: 44,552,260 probably benign Het
Olfr1361 C A 13: 21,659,146 R59L probably damaging Het
Olfr205 A T 16: 59,328,760 F250I probably damaging Het
Olfr682-ps1 A G 7: 105,128,218 V73A possibly damaging Het
Olfr71 A T 4: 43,706,592 probably null Het
P4hb G A 11: 120,568,244 T141I possibly damaging Het
Polr3a A G 14: 24,484,134 V101A probably benign Het
Pou4f2 A G 8: 78,435,240 S245P probably benign Het
Rnpep A G 1: 135,272,419 V266A probably damaging Het
Scly G A 1: 91,309,833 G206R probably damaging Het
Sec14l3 A T 11: 4,074,814 K254N probably damaging Het
Sgpp1 A T 12: 75,735,100 I155N probably damaging Het
Slc22a14 A G 9: 119,172,124 L468P probably damaging Het
Slc22a27 A G 19: 7,865,884 F377L probably benign Het
Slc44a3 T C 3: 121,460,070 I625V probably benign Het
Slc47a2 A T 11: 61,309,976 I373N probably damaging Het
Slfn10-ps A T 11: 83,035,653 noncoding transcript Het
Smarcd1 T A 15: 99,711,094 I383N probably damaging Het
Sort1 A G 3: 108,338,910 D401G probably damaging Het
Sprr2a3 G T 3: 92,288,590 M1I probably null Het
Sycp2 A C 2: 178,356,580 V1049G possibly damaging Het
Tecrl T A 5: 83,354,928 K10* probably null Het
Tnpo3 A T 6: 29,578,565 C303* probably null Het
Vmn2r23 A G 6: 123,729,721 I503M probably benign Het
Zbtb8os T A 4: 129,346,877 I164N probably damaging Het
Zfp292 T C 4: 34,807,399 N1882D probably benign Het
Zfp91 T C 19: 12,770,095 I555V possibly damaging Het
Other mutations in Il5ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Il5ra APN 6 106712474 splice site probably benign
IGL00726:Il5ra APN 6 106738489 missense probably damaging 1.00
IGL01095:Il5ra APN 6 106742644 intron probably benign
IGL01562:Il5ra APN 6 106731904 missense probably benign 0.00
IGL01569:Il5ra APN 6 106731833 start codon destroyed probably null
IGL02346:Il5ra APN 6 106742658 missense probably benign 0.02
IGL02573:Il5ra APN 6 106716751 missense possibly damaging 0.93
IGL02659:Il5ra APN 6 106742683 missense possibly damaging 0.49
R0037:Il5ra UTSW 6 106742686 missense probably damaging 1.00
R0037:Il5ra UTSW 6 106742686 missense probably damaging 1.00
R0294:Il5ra UTSW 6 106712401 missense probably benign 0.41
R0463:Il5ra UTSW 6 106731890 missense probably damaging 0.99
R0478:Il5ra UTSW 6 106738462 missense probably benign
R1526:Il5ra UTSW 6 106735820 missense possibly damaging 0.49
R1695:Il5ra UTSW 6 106738374 nonsense probably null
R1888:Il5ra UTSW 6 106731913 missense probably damaging 1.00
R1888:Il5ra UTSW 6 106731913 missense probably damaging 1.00
R2176:Il5ra UTSW 6 106738272 missense probably benign
R2207:Il5ra UTSW 6 106712441 nonsense probably null
R2973:Il5ra UTSW 6 106741235 missense probably benign 0.08
R4546:Il5ra UTSW 6 106738498 nonsense probably null
R4842:Il5ra UTSW 6 106738375 missense probably damaging 1.00
R4851:Il5ra UTSW 6 106738471 missense probably benign 0.06
R4911:Il5ra UTSW 6 106715668 missense probably damaging 1.00
R4936:Il5ra UTSW 6 106738162 missense possibly damaging 0.90
R5297:Il5ra UTSW 6 106738134 missense probably benign 0.09
R6035:Il5ra UTSW 6 106741265 missense probably damaging 1.00
R6035:Il5ra UTSW 6 106741265 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACGATGCCCGTTTGTACTCTTAG -3'
(R):5'- TCTTCAGCCCAAGAGCAAAGTTCC -3'

Sequencing Primer
(F):5'- CACATGGCCTTCTTAAATCTCAAG -3'
(R):5'- GAGCAAAGTTCCATATGTTTGCG -3'
Posted On2013-07-11