Incidental Mutation 'R7106:Rpap2'
ID551170
Institutional Source Beutler Lab
Gene Symbol Rpap2
Ensembl Gene ENSMUSG00000033773
Gene NameRNA polymerase II associated protein 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7106 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location107597373-107661838 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 107633122 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 565 (L565*)
Ref Sequence ENSEMBL: ENSMUSP00000070209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065422] [ENSMUST00000112650] [ENSMUST00000112651] [ENSMUST00000112654] [ENSMUST00000112655]
Predicted Effect probably null
Transcript: ENSMUST00000065422
AA Change: L565*
SMART Domains Protein: ENSMUSP00000070209
Gene: ENSMUSG00000033773
AA Change: L565*

DomainStartEndE-ValueType
Pfam:RPAP2_Rtr1 80 152 3.6e-26 PFAM
low complexity region 208 221 N/A INTRINSIC
low complexity region 373 384 N/A INTRINSIC
low complexity region 559 573 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112650
AA Change: L486*
SMART Domains Protein: ENSMUSP00000108269
Gene: ENSMUSG00000033773
AA Change: L486*

DomainStartEndE-ValueType
Pfam:RPAP2_Rtr1 1 74 1.7e-28 PFAM
low complexity region 129 142 N/A INTRINSIC
low complexity region 294 305 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112651
AA Change: L488*
SMART Domains Protein: ENSMUSP00000108270
Gene: ENSMUSG00000033773
AA Change: L488*

DomainStartEndE-ValueType
Pfam:RPAP2_Rtr1 1 76 1.9e-28 PFAM
low complexity region 131 144 N/A INTRINSIC
low complexity region 296 307 N/A INTRINSIC
low complexity region 482 496 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112654
AA Change: L565*
SMART Domains Protein: ENSMUSP00000108273
Gene: ENSMUSG00000033773
AA Change: L565*

DomainStartEndE-ValueType
Pfam:RPAP2_Rtr1 78 153 1.8e-28 PFAM
low complexity region 208 221 N/A INTRINSIC
low complexity region 373 384 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112655
AA Change: L565*
SMART Domains Protein: ENSMUSP00000108274
Gene: ENSMUSG00000033773
AA Change: L565*

DomainStartEndE-ValueType
Pfam:RPAP2_Rtr1 78 153 4.1e-28 PFAM
low complexity region 208 221 N/A INTRINSIC
low complexity region 373 384 N/A INTRINSIC
low complexity region 560 570 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldob T C 4: 49,541,258 Y138C probably damaging Het
Ano7 A C 1: 93,374,983 probably null Het
Arvcf T A 16: 18,399,049 V497E probably damaging Het
Atad2 A G 15: 58,116,766 probably null Het
Brinp1 C T 4: 68,829,378 A163T probably benign Het
Catsperd C A 17: 56,658,070 probably null Het
Ccm2l A G 2: 153,070,651 H70R possibly damaging Het
Cgnl1 G A 9: 71,725,733 T112I probably benign Het
Chid1 T C 7: 141,522,660 H220R probably benign Het
Clca1 A G 3: 145,027,429 V106A probably damaging Het
Cldn23 A C 8: 35,825,915 S140A probably benign Het
Dennd2c T C 3: 103,131,577 S14P possibly damaging Het
Det1 T C 7: 78,843,464 D264G probably damaging Het
Dmwd T C 7: 19,080,529 V368A probably damaging Het
Dnah11 T C 12: 117,961,149 K3362E probably benign Het
Dnah8 T C 17: 30,741,178 F2208L probably damaging Het
Dnaja3 T C 16: 4,705,934 I477T probably benign Het
Dnmt3a A G 12: 3,897,591 K482E probably damaging Het
Dock7 A G 4: 98,967,326 I1493T unknown Het
Ehbp1l1 A G 19: 5,718,737 V846A probably benign Het
Fbxl4 T A 4: 22,427,140 probably null Het
Fgd2 T A 17: 29,376,970 L534* probably null Het
Fgfr3 T C 5: 33,731,414 V349A probably damaging Het
Gal3st1 A T 11: 3,998,509 I239F probably damaging Het
Gpatch3 C A 4: 133,578,203 H250N probably benign Het
Guca1b A T 17: 47,391,311 K230* probably null Het
Itga3 G T 11: 95,055,873 L737I probably benign Het
Kmt5c A G 7: 4,742,706 K122E probably damaging Het
Kpna4 G A 3: 69,079,464 Q531* probably null Het
Lctl A G 9: 64,132,837 E410G probably benign Het
Lhx1 T C 11: 84,522,077 N128D probably benign Het
Lifr A G 15: 7,172,924 N349D probably benign Het
Map2 G A 1: 66,410,744 A209T possibly damaging Het
Mif4gd G A 11: 115,611,911 A25V probably damaging Het
Mug2 T C 6: 122,082,721 S1353P probably damaging Het
Myh9 A G 15: 77,775,121 C931R probably benign Het
Nelfe T G 17: 34,852,419 probably null Het
Nrf1 A G 6: 30,102,184 S161G probably benign Het
Pik3c2a G A 7: 116,418,133 Q130* probably null Het
Prex2 T A 1: 11,136,793 M525K probably benign Het
Psme2 A G 14: 55,588,237 S165P probably benign Het
Rapgef2 A G 3: 79,066,608 F1477S probably benign Het
Rasef A T 4: 73,727,627 C502S probably damaging Het
Sav1 A G 12: 69,984,616 I44T probably damaging Het
Selp T A 1: 164,126,422 I97N probably benign Het
Serpina1d A G 12: 103,765,721 F293S probably benign Het
Sin3b T C 8: 72,724,137 F65L possibly damaging Het
Sorcs3 G C 19: 48,705,963 G559R probably damaging Het
Susd2 A T 10: 75,638,053 D689E probably damaging Het
Tas1r2 A T 4: 139,662,049 M448L probably benign Het
Tbc1d30 A T 10: 121,301,992 I181N possibly damaging Het
Tcea3 A G 4: 136,271,368 T318A probably damaging Het
Tomm70a T C 16: 57,140,758 V358A probably damaging Het
Tpp1 A C 7: 105,749,911 S153A possibly damaging Het
Trip13 C T 13: 73,914,532 V387I probably benign Het
Ttn T C 2: 76,797,488 I14704V probably benign Het
Uimc1 C A 13: 55,050,815 C516F possibly damaging Het
Vit A G 17: 78,586,799 N210S probably benign Het
Vmn1r22 G T 6: 57,900,311 T227K probably damaging Het
Vmn2r5 A G 3: 64,491,683 I625T probably benign Het
Zfp27 AATCCGCTTGTGCA AA 7: 29,895,021 probably benign Het
Zfp384 T C 6: 125,024,259 L98P probably benign Het
Zfp809 G T 9: 22,236,224 K51N probably benign Het
Other mutations in Rpap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00654:Rpap2 APN 5 107603631 unclassified probably benign
IGL01451:Rpap2 APN 5 107603626 critical splice donor site probably null
IGL01583:Rpap2 APN 5 107620195 missense probably damaging 0.99
IGL01837:Rpap2 APN 5 107625969 critical splice donor site probably null
IGL02343:Rpap2 APN 5 107618181 splice site probably null
IGL02999:Rpap2 APN 5 107601831 missense possibly damaging 0.61
IGL03261:Rpap2 APN 5 107598560 missense possibly damaging 0.95
IGL03381:Rpap2 APN 5 107620201 missense probably benign 0.00
R0077:Rpap2 UTSW 5 107620474 missense probably damaging 1.00
R1698:Rpap2 UTSW 5 107603550 missense probably damaging 1.00
R1897:Rpap2 UTSW 5 107633095 missense possibly damaging 0.85
R3039:Rpap2 UTSW 5 107601795 missense possibly damaging 0.95
R3605:Rpap2 UTSW 5 107620529 missense probably damaging 1.00
R3735:Rpap2 UTSW 5 107655151 splice site probably benign
R4007:Rpap2 UTSW 5 107603872 missense probably damaging 1.00
R4367:Rpap2 UTSW 5 107601795 missense possibly damaging 0.95
R4448:Rpap2 UTSW 5 107601795 missense possibly damaging 0.95
R4589:Rpap2 UTSW 5 107620495 missense probably benign 0.00
R4606:Rpap2 UTSW 5 107601795 missense possibly damaging 0.95
R4799:Rpap2 UTSW 5 107620247 missense probably benign 0.00
R4939:Rpap2 UTSW 5 107603625 critical splice donor site probably null
R5580:Rpap2 UTSW 5 107620145 missense probably benign 0.12
R6003:Rpap2 UTSW 5 107601901 unclassified probably null
R6032:Rpap2 UTSW 5 107597795 missense probably damaging 0.97
R6032:Rpap2 UTSW 5 107597795 missense probably damaging 0.97
R6142:Rpap2 UTSW 5 107598298 missense probably benign
R6161:Rpap2 UTSW 5 107620670 missense probably damaging 1.00
R6687:Rpap2 UTSW 5 107603630 splice site probably null
R6761:Rpap2 UTSW 5 107620238 missense probably benign
R6783:Rpap2 UTSW 5 107655287 missense probably damaging 0.99
R7314:Rpap2 UTSW 5 107620379 missense probably damaging 0.96
R7402:Rpap2 UTSW 5 107620458 nonsense probably null
R7644:Rpap2 UTSW 5 107620301 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ACAGAGCTGCACTAATGTCC -3'
(R):5'- CACAAGGTAACATTACAGCTTCTC -3'

Sequencing Primer
(F):5'- GCCCATTGGTTACAAGTATTGC -3'
(R):5'- GCTTCTCAAAATACAGCATACATGG -3'
Posted On2019-05-15