Incidental Mutation 'R7106:Dmwd'
ID551176
Institutional Source Beutler Lab
Gene Symbol Dmwd
Ensembl Gene ENSMUSG00000030410
Gene Namedystrophia myotonica-containing WD repeat motif
SynonymsDm9, 59, DMR-N9
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #R7106 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location19076227-19082776 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19080529 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 368 (V368A)
Ref Sequence ENSEMBL: ENSMUSP00000032570 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032568] [ENSMUST00000032570] [ENSMUST00000108473] [ENSMUST00000108474] [ENSMUST00000108479] [ENSMUST00000122999] [ENSMUST00000154199]
Predicted Effect probably benign
Transcript: ENSMUST00000032568
SMART Domains Protein: ENSMUSP00000032568
Gene: ENSMUSG00000030409

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 339 6.5e-87 SMART
S_TK_X 340 407 3.6e-11 SMART
Pfam:DMPK_coil 472 532 2.8e-25 PFAM
low complexity region 590 613 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000032570
AA Change: V368A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032570
Gene: ENSMUSG00000030410
AA Change: V368A

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
low complexity region 44 92 N/A INTRINSIC
WD40 203 239 4.11e1 SMART
WD40 270 309 3.5e-4 SMART
WD40 312 351 2.01e-4 SMART
WD40 354 436 8.36e-2 SMART
low complexity region 450 471 N/A INTRINSIC
low complexity region 477 503 N/A INTRINSIC
Blast:WD40 509 620 1e-43 BLAST
low complexity region 653 662 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108473
SMART Domains Protein: ENSMUSP00000104113
Gene: ENSMUSG00000030409

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 339 1.36e-84 SMART
S_TK_X 340 407 7.5e-9 SMART
Pfam:DMPK_coil 472 532 2.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108474
SMART Domains Protein: ENSMUSP00000104114
Gene: ENSMUSG00000030409

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 336 2.57e-76 SMART
Pfam:DMPK_coil 446 506 2.4e-28 PFAM
low complexity region 564 587 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108479
AA Change: V368A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104119
Gene: ENSMUSG00000030410
AA Change: V368A

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
low complexity region 44 92 N/A INTRINSIC
WD40 203 239 4.11e1 SMART
WD40 270 309 3.5e-4 SMART
WD40 312 351 2.01e-4 SMART
WD40 354 436 8.36e-2 SMART
low complexity region 450 471 N/A INTRINSIC
low complexity region 477 503 N/A INTRINSIC
Blast:WD40 509 620 1e-43 BLAST
low complexity region 628 637 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122999
SMART Domains Protein: ENSMUSP00000123516
Gene: ENSMUSG00000030409

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
PDB:2VD5|B 32 139 3e-62 PDB
SCOP:d1koba_ 44 139 3e-21 SMART
Blast:S_TKc 71 139 7e-36 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000154199
SMART Domains Protein: ENSMUSP00000118459
Gene: ENSMUSG00000030409

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 339 1.36e-84 SMART
S_TK_X 340 402 5.3e-9 SMART
Pfam:DMPK_coil 467 527 2.3e-28 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldob T C 4: 49,541,258 Y138C probably damaging Het
Ano7 A C 1: 93,374,983 probably null Het
Arvcf T A 16: 18,399,049 V497E probably damaging Het
Atad2 A G 15: 58,116,766 probably null Het
Brinp1 C T 4: 68,829,378 A163T probably benign Het
Catsperd C A 17: 56,658,070 probably null Het
Ccm2l A G 2: 153,070,651 H70R possibly damaging Het
Cgnl1 G A 9: 71,725,733 T112I probably benign Het
Chid1 T C 7: 141,522,660 H220R probably benign Het
Clca1 A G 3: 145,027,429 V106A probably damaging Het
Cldn23 A C 8: 35,825,915 S140A probably benign Het
Dennd2c T C 3: 103,131,577 S14P possibly damaging Het
Det1 T C 7: 78,843,464 D264G probably damaging Het
Dnah11 T C 12: 117,961,149 K3362E probably benign Het
Dnah8 T C 17: 30,741,178 F2208L probably damaging Het
Dnaja3 T C 16: 4,705,934 I477T probably benign Het
Dnmt3a A G 12: 3,897,591 K482E probably damaging Het
Dock7 A G 4: 98,967,326 I1493T unknown Het
Ehbp1l1 A G 19: 5,718,737 V846A probably benign Het
Fbxl4 T A 4: 22,427,140 probably null Het
Fgd2 T A 17: 29,376,970 L534* probably null Het
Fgfr3 T C 5: 33,731,414 V349A probably damaging Het
Gal3st1 A T 11: 3,998,509 I239F probably damaging Het
Gpatch3 C A 4: 133,578,203 H250N probably benign Het
Guca1b A T 17: 47,391,311 K230* probably null Het
Itga3 G T 11: 95,055,873 L737I probably benign Het
Kmt5c A G 7: 4,742,706 K122E probably damaging Het
Kpna4 G A 3: 69,079,464 Q531* probably null Het
Lctl A G 9: 64,132,837 E410G probably benign Het
Lhx1 T C 11: 84,522,077 N128D probably benign Het
Lifr A G 15: 7,172,924 N349D probably benign Het
Map2 G A 1: 66,410,744 A209T possibly damaging Het
Mif4gd G A 11: 115,611,911 A25V probably damaging Het
Mug2 T C 6: 122,082,721 S1353P probably damaging Het
Myh9 A G 15: 77,775,121 C931R probably benign Het
Nelfe T G 17: 34,852,419 probably null Het
Nrf1 A G 6: 30,102,184 S161G probably benign Het
Pik3c2a G A 7: 116,418,133 Q130* probably null Het
Prex2 T A 1: 11,136,793 M525K probably benign Het
Psme2 A G 14: 55,588,237 S165P probably benign Het
Rapgef2 A G 3: 79,066,608 F1477S probably benign Het
Rasef A T 4: 73,727,627 C502S probably damaging Het
Rpap2 T A 5: 107,633,122 L565* probably null Het
Sav1 A G 12: 69,984,616 I44T probably damaging Het
Selp T A 1: 164,126,422 I97N probably benign Het
Serpina1d A G 12: 103,765,721 F293S probably benign Het
Sin3b T C 8: 72,724,137 F65L possibly damaging Het
Sorcs3 G C 19: 48,705,963 G559R probably damaging Het
Susd2 A T 10: 75,638,053 D689E probably damaging Het
Tas1r2 A T 4: 139,662,049 M448L probably benign Het
Tbc1d30 A T 10: 121,301,992 I181N possibly damaging Het
Tcea3 A G 4: 136,271,368 T318A probably damaging Het
Tomm70a T C 16: 57,140,758 V358A probably damaging Het
Tpp1 A C 7: 105,749,911 S153A possibly damaging Het
Trip13 C T 13: 73,914,532 V387I probably benign Het
Ttn T C 2: 76,797,488 I14704V probably benign Het
Uimc1 C A 13: 55,050,815 C516F possibly damaging Het
Vit A G 17: 78,586,799 N210S probably benign Het
Vmn1r22 G T 6: 57,900,311 T227K probably damaging Het
Vmn2r5 A G 3: 64,491,683 I625T probably benign Het
Zfp27 AATCCGCTTGTGCA AA 7: 29,895,021 probably benign Het
Zfp384 T C 6: 125,024,259 L98P probably benign Het
Zfp809 G T 9: 22,236,224 K51N probably benign Het
Other mutations in Dmwd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01620:Dmwd APN 7 19081234 unclassified probably null
IGL01668:Dmwd APN 7 19081155 missense probably damaging 1.00
IGL02705:Dmwd APN 7 19080844 missense probably benign 0.02
IGL03036:Dmwd APN 7 19081129 missense probably damaging 1.00
IGL03133:Dmwd APN 7 19076637 missense probably damaging 1.00
PIT4305001:Dmwd UTSW 7 19080718 missense probably damaging 0.99
R0172:Dmwd UTSW 7 19080342 missense probably damaging 1.00
R1619:Dmwd UTSW 7 19081034 unclassified probably benign
R2055:Dmwd UTSW 7 19076685 missense probably benign 0.34
R2058:Dmwd UTSW 7 19080727 missense probably damaging 1.00
R2403:Dmwd UTSW 7 19081159 missense possibly damaging 0.94
R2922:Dmwd UTSW 7 19076345 missense probably damaging 1.00
R3122:Dmwd UTSW 7 19080695 missense probably damaging 1.00
R4876:Dmwd UTSW 7 19080547 missense probably damaging 1.00
R4937:Dmwd UTSW 7 19081303 critical splice donor site probably null
R5018:Dmwd UTSW 7 19078119 missense probably damaging 0.99
R5034:Dmwd UTSW 7 19080294 missense probably damaging 1.00
R5165:Dmwd UTSW 7 19078035 intron probably benign
R5265:Dmwd UTSW 7 19080281 missense possibly damaging 0.89
R5559:Dmwd UTSW 7 19080438 missense probably damaging 0.99
R6695:Dmwd UTSW 7 19080727 missense probably damaging 1.00
R7208:Dmwd UTSW 7 19080309 missense probably benign 0.05
R7681:Dmwd UTSW 7 19081082 missense probably benign 0.23
R7683:Dmwd UTSW 7 19080735 missense probably damaging 1.00
R7760:Dmwd UTSW 7 19080735 missense probably damaging 1.00
R7763:Dmwd UTSW 7 19080340 missense probably damaging 1.00
R7814:Dmwd UTSW 7 19080843 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTGACAGCATGCTTCTGCG -3'
(R):5'- ATGAGGGGAGAGCACATCTTC -3'

Sequencing Primer
(F):5'- CTGCGTGGGCTCATGAAG -3'
(R):5'- CAGGCAGAACTGTGTGTCCTG -3'
Posted On2019-05-15