Incidental Mutation 'R7106:Susd2'
ID551187
Institutional Source Beutler Lab
Gene Symbol Susd2
Ensembl Gene ENSMUSG00000006342
Gene Namesushi domain containing 2
Synonyms1200011D11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R7106 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location75636706-75644008 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 75638053 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 689 (D689E)
Ref Sequence ENSEMBL: ENSMUSP00000093197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077610] [ENSMUST00000095541]
Predicted Effect probably damaging
Transcript: ENSMUST00000077610
AA Change: D569E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076802
Gene: ENSMUSG00000006342
AA Change: D569E

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
AMOP 162 310 4.09e-82 SMART
VWD 313 489 1.9e-19 SMART
CCP 602 655 3.37e-17 SMART
transmembrane domain 663 685 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000095541
AA Change: D689E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093197
Gene: ENSMUSG00000006342
AA Change: D689E

DomainStartEndE-ValueType
SO 25 64 4.77e-2 SMART
AMOP 282 430 4.09e-82 SMART
VWD 433 609 1.9e-19 SMART
CCP 722 775 3.37e-17 SMART
transmembrane domain 783 805 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldob T C 4: 49,541,258 Y138C probably damaging Het
Ano7 A C 1: 93,374,983 probably null Het
Arvcf T A 16: 18,399,049 V497E probably damaging Het
Atad2 A G 15: 58,116,766 probably null Het
Brinp1 C T 4: 68,829,378 A163T probably benign Het
Catsperd C A 17: 56,658,070 probably null Het
Ccm2l A G 2: 153,070,651 H70R possibly damaging Het
Cgnl1 G A 9: 71,725,733 T112I probably benign Het
Chid1 T C 7: 141,522,660 H220R probably benign Het
Clca1 A G 3: 145,027,429 V106A probably damaging Het
Cldn23 A C 8: 35,825,915 S140A probably benign Het
Dennd2c T C 3: 103,131,577 S14P possibly damaging Het
Det1 T C 7: 78,843,464 D264G probably damaging Het
Dmwd T C 7: 19,080,529 V368A probably damaging Het
Dnah11 T C 12: 117,961,149 K3362E probably benign Het
Dnah8 T C 17: 30,741,178 F2208L probably damaging Het
Dnaja3 T C 16: 4,705,934 I477T probably benign Het
Dnmt3a A G 12: 3,897,591 K482E probably damaging Het
Dock7 A G 4: 98,967,326 I1493T unknown Het
Ehbp1l1 A G 19: 5,718,737 V846A probably benign Het
Fbxl4 T A 4: 22,427,140 probably null Het
Fgd2 T A 17: 29,376,970 L534* probably null Het
Fgfr3 T C 5: 33,731,414 V349A probably damaging Het
Gal3st1 A T 11: 3,998,509 I239F probably damaging Het
Gpatch3 C A 4: 133,578,203 H250N probably benign Het
Guca1b A T 17: 47,391,311 K230* probably null Het
Itga3 G T 11: 95,055,873 L737I probably benign Het
Kmt5c A G 7: 4,742,706 K122E probably damaging Het
Kpna4 G A 3: 69,079,464 Q531* probably null Het
Lctl A G 9: 64,132,837 E410G probably benign Het
Lhx1 T C 11: 84,522,077 N128D probably benign Het
Lifr A G 15: 7,172,924 N349D probably benign Het
Map2 G A 1: 66,410,744 A209T possibly damaging Het
Mif4gd G A 11: 115,611,911 A25V probably damaging Het
Mug2 T C 6: 122,082,721 S1353P probably damaging Het
Myh9 A G 15: 77,775,121 C931R probably benign Het
Nelfe T G 17: 34,852,419 probably null Het
Nrf1 A G 6: 30,102,184 S161G probably benign Het
Pik3c2a G A 7: 116,418,133 Q130* probably null Het
Prex2 T A 1: 11,136,793 M525K probably benign Het
Psme2 A G 14: 55,588,237 S165P probably benign Het
Rapgef2 A G 3: 79,066,608 F1477S probably benign Het
Rasef A T 4: 73,727,627 C502S probably damaging Het
Rpap2 T A 5: 107,633,122 L565* probably null Het
Sav1 A G 12: 69,984,616 I44T probably damaging Het
Selp T A 1: 164,126,422 I97N probably benign Het
Serpina1d A G 12: 103,765,721 F293S probably benign Het
Sin3b T C 8: 72,724,137 F65L possibly damaging Het
Sorcs3 G C 19: 48,705,963 G559R probably damaging Het
Tas1r2 A T 4: 139,662,049 M448L probably benign Het
Tbc1d30 A T 10: 121,301,992 I181N possibly damaging Het
Tcea3 A G 4: 136,271,368 T318A probably damaging Het
Tomm70a T C 16: 57,140,758 V358A probably damaging Het
Tpp1 A C 7: 105,749,911 S153A possibly damaging Het
Trip13 C T 13: 73,914,532 V387I probably benign Het
Ttn T C 2: 76,797,488 I14704V probably benign Het
Uimc1 C A 13: 55,050,815 C516F possibly damaging Het
Vit A G 17: 78,586,799 N210S probably benign Het
Vmn1r22 G T 6: 57,900,311 T227K probably damaging Het
Vmn2r5 A G 3: 64,491,683 I625T probably benign Het
Zfp27 AATCCGCTTGTGCA AA 7: 29,895,021 probably benign Het
Zfp384 T C 6: 125,024,259 L98P probably benign Het
Zfp809 G T 9: 22,236,224 K51N probably benign Het
Other mutations in Susd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00740:Susd2 APN 10 75638048 missense probably benign 0.02
IGL00907:Susd2 APN 10 75640931 missense probably benign 0.04
IGL01155:Susd2 APN 10 75640892 missense possibly damaging 0.87
IGL01677:Susd2 APN 10 75639431 missense possibly damaging 0.91
IGL02146:Susd2 APN 10 75638433 missense possibly damaging 0.79
IGL02273:Susd2 APN 10 75640938 missense possibly damaging 0.94
IGL02386:Susd2 APN 10 75640095 missense probably damaging 0.97
IGL02475:Susd2 APN 10 75637499 critical splice donor site probably null
IGL03218:Susd2 APN 10 75642625 missense probably benign
PIT4418001:Susd2 UTSW 10 75638349 missense probably benign 0.24
R0135:Susd2 UTSW 10 75638514 missense probably damaging 1.00
R0396:Susd2 UTSW 10 75639911 missense probably damaging 1.00
R0401:Susd2 UTSW 10 75638603 splice site probably benign
R0608:Susd2 UTSW 10 75638235 missense probably benign 0.45
R0636:Susd2 UTSW 10 75639350 missense probably damaging 1.00
R1470:Susd2 UTSW 10 75638054 missense probably damaging 1.00
R1470:Susd2 UTSW 10 75638054 missense probably damaging 1.00
R1619:Susd2 UTSW 10 75638044 missense possibly damaging 0.66
R1634:Susd2 UTSW 10 75637555 missense probably benign 0.04
R1866:Susd2 UTSW 10 75639732 missense probably damaging 0.98
R4354:Susd2 UTSW 10 75639728 missense probably damaging 0.99
R4451:Susd2 UTSW 10 75639398 missense probably damaging 1.00
R4721:Susd2 UTSW 10 75638130 missense probably benign 0.00
R5546:Susd2 UTSW 10 75642218 missense probably benign 0.01
R5768:Susd2 UTSW 10 75638019 missense probably damaging 0.98
R5769:Susd2 UTSW 10 75638019 missense probably damaging 0.98
R5770:Susd2 UTSW 10 75638019 missense probably damaging 0.98
R5771:Susd2 UTSW 10 75638019 missense probably damaging 0.98
R5960:Susd2 UTSW 10 75639936 missense probably damaging 1.00
R6152:Susd2 UTSW 10 75638019 missense probably damaging 0.98
R6153:Susd2 UTSW 10 75638019 missense probably damaging 0.98
R6259:Susd2 UTSW 10 75638046 missense probably damaging 1.00
R6291:Susd2 UTSW 10 75637574 missense possibly damaging 0.61
R7232:Susd2 UTSW 10 75639851 missense probably damaging 1.00
R7297:Susd2 UTSW 10 75642568 missense probably benign 0.19
R7326:Susd2 UTSW 10 75642565 missense probably benign 0.00
R7905:Susd2 UTSW 10 75639657 nonsense probably null
R8512:Susd2 UTSW 10 75639651 missense probably benign 0.13
X0025:Susd2 UTSW 10 75640572 nonsense probably null
Z1177:Susd2 UTSW 10 75640478 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AACTGCTGGCCACTGAATG -3'
(R):5'- AGAGAAACTTGTCTGTGCCCAC -3'

Sequencing Primer
(F):5'- TGCTAGGCGATCTGAGA -3'
(R):5'- AGGGGCTGTTTCCAACAC -3'
Posted On2019-05-15