Incidental Mutation 'R7106:Gal3st1'
ID 551189
Institutional Source Beutler Lab
Gene Symbol Gal3st1
Ensembl Gene ENSMUSG00000049721
Gene Name galactose-3-O-sulfotransferase 1
Synonyms GalCer sulfotransferase, Gcst, Cst, galactosylceramide sulfotransferase, 3'-phosphoadenylylsulfate-galactosylceramide 3'-sulfotransferase
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7106 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 3983636-3999326 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 3998509 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 239 (I239F)
Ref Sequence ENSEMBL: ENSMUSP00000058348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063004] [ENSMUST00000078757] [ENSMUST00000109981]
AlphaFold Q9JHE4
Predicted Effect probably damaging
Transcript: ENSMUST00000063004
AA Change: I239F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000058348
Gene: ENSMUSG00000049721
AA Change: I239F

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 1 408 1.2e-184 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000078757
AA Change: I239F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000077815
Gene: ENSMUSG00000049721
AA Change: I239F

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 1 408 1.2e-184 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109981
AA Change: I239F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105608
Gene: ENSMUSG00000049721
AA Change: I239F

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 1 408 1.2e-184 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sulfonation, an important step in the metabolism of many drugs, xenobiotics, hormones, and neurotransmitters, is catalyzed by sulfotransferases. This gene encodes galactosylceramide sulfotransferase, which catalyzes the sulfation of membrane glycolipids including the final step in the synthesis of sulfatide, a major lipid component of the myelin sheath. This gene exhibits elevated expression in ovarian epithelial carcinoma and the encoded enzyme exhibits elevated activity in renal cell carcinoma. Mutations in this gene may be associated with reduced insulin resistance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit hindlimb weakness and progressive ataxia beginning at six weeks of age. Homozygous males exhibit sterility with a block in spermatogenesis prior to the first meiotic division. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldob T C 4: 49,541,258 Y138C probably damaging Het
Ano7 A C 1: 93,374,983 probably null Het
Arvcf T A 16: 18,399,049 V497E probably damaging Het
Atad2 A G 15: 58,116,766 probably null Het
Brinp1 C T 4: 68,829,378 A163T probably benign Het
Catsperd C A 17: 56,658,070 probably null Het
Ccm2l A G 2: 153,070,651 H70R possibly damaging Het
Cgnl1 G A 9: 71,725,733 T112I probably benign Het
Chid1 T C 7: 141,522,660 H220R probably benign Het
Clca1 A G 3: 145,027,429 V106A probably damaging Het
Cldn23 A C 8: 35,825,915 S140A probably benign Het
Dennd2c T C 3: 103,131,577 S14P possibly damaging Het
Det1 T C 7: 78,843,464 D264G probably damaging Het
Dmwd T C 7: 19,080,529 V368A probably damaging Het
Dnah11 T C 12: 117,961,149 K3362E probably benign Het
Dnah8 T C 17: 30,741,178 F2208L probably damaging Het
Dnaja3 T C 16: 4,705,934 I477T probably benign Het
Dnmt3a A G 12: 3,897,591 K482E probably damaging Het
Dock7 A G 4: 98,967,326 I1493T unknown Het
Ehbp1l1 A G 19: 5,718,737 V846A probably benign Het
Fbxl4 T A 4: 22,427,140 probably null Het
Fgd2 T A 17: 29,376,970 L534* probably null Het
Fgfr3 T C 5: 33,731,414 V349A probably damaging Het
Gpatch3 C A 4: 133,578,203 H250N probably benign Het
Guca1b A T 17: 47,391,311 K230* probably null Het
Itga3 G T 11: 95,055,873 L737I probably benign Het
Kmt5c A G 7: 4,742,706 K122E probably damaging Het
Kpna4 G A 3: 69,079,464 Q531* probably null Het
Lctl A G 9: 64,132,837 E410G probably benign Het
Lhx1 T C 11: 84,522,077 N128D probably benign Het
Lifr A G 15: 7,172,924 N349D probably benign Het
Map2 G A 1: 66,410,744 A209T possibly damaging Het
Mif4gd G A 11: 115,611,911 A25V probably damaging Het
Mug2 T C 6: 122,082,721 S1353P probably damaging Het
Myh9 A G 15: 77,775,121 C931R probably benign Het
Nelfe T G 17: 34,852,419 probably null Het
Nrf1 A G 6: 30,102,184 S161G probably benign Het
Pik3c2a G A 7: 116,418,133 Q130* probably null Het
Prex2 T A 1: 11,136,793 M525K probably benign Het
Psme2 A G 14: 55,588,237 S165P probably benign Het
Rapgef2 A G 3: 79,066,608 F1477S probably benign Het
Rasef A T 4: 73,727,627 C502S probably damaging Het
Rpap2 T A 5: 107,633,122 L565* probably null Het
Sav1 A G 12: 69,984,616 I44T probably damaging Het
Selp T A 1: 164,126,422 I97N probably benign Het
Serpina1d A G 12: 103,765,721 F293S probably benign Het
Sin3b T C 8: 72,724,137 F65L possibly damaging Het
Sorcs3 G C 19: 48,705,963 G559R probably damaging Het
Susd2 A T 10: 75,638,053 D689E probably damaging Het
Tas1r2 A T 4: 139,662,049 M448L probably benign Het
Tbc1d30 A T 10: 121,301,992 I181N possibly damaging Het
Tcea3 A G 4: 136,271,368 T318A probably damaging Het
Tomm70a T C 16: 57,140,758 V358A probably damaging Het
Tpp1 A C 7: 105,749,911 S153A possibly damaging Het
Trip13 C T 13: 73,914,532 V387I probably benign Het
Ttn T C 2: 76,797,488 I14704V probably benign Het
Uimc1 C A 13: 55,050,815 C516F possibly damaging Het
Vit A G 17: 78,586,799 N210S probably benign Het
Vmn1r22 G T 6: 57,900,311 T227K probably damaging Het
Vmn2r5 A G 3: 64,491,683 I625T probably benign Het
Zfp27 AATCCGCTTGTGCA AA 7: 29,895,021 probably benign Het
Zfp384 T C 6: 125,024,259 L98P probably benign Het
Zfp809 G T 9: 22,236,224 K51N probably benign Het
Other mutations in Gal3st1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Gal3st1 APN 11 3999070 utr 3 prime probably benign
IGL01010:Gal3st1 APN 11 3996914 utr 5 prime probably benign
IGL01079:Gal3st1 APN 11 3998564 missense probably damaging 1.00
IGL01306:Gal3st1 APN 11 3998405 missense probably damaging 1.00
IGL01614:Gal3st1 APN 11 3998996 missense probably damaging 1.00
IGL01990:Gal3st1 APN 11 3998741 missense probably damaging 1.00
IGL02439:Gal3st1 APN 11 3998110 missense possibly damaging 0.95
R0306:Gal3st1 UTSW 11 3998546 missense probably damaging 1.00
R1075:Gal3st1 UTSW 11 3998509 missense possibly damaging 0.80
R1171:Gal3st1 UTSW 11 3998931 missense probably damaging 1.00
R1874:Gal3st1 UTSW 11 3998231 missense probably damaging 1.00
R2230:Gal3st1 UTSW 11 3998282 missense probably benign 0.31
R2231:Gal3st1 UTSW 11 3998282 missense probably benign 0.31
R2232:Gal3st1 UTSW 11 3998282 missense probably benign 0.31
R2985:Gal3st1 UTSW 11 3998618 missense probably damaging 1.00
R3552:Gal3st1 UTSW 11 3998110 missense possibly damaging 0.90
R6737:Gal3st1 UTSW 11 3998903 missense probably benign 0.00
R7027:Gal3st1 UTSW 11 3999002 missense probably damaging 0.96
R7288:Gal3st1 UTSW 11 3998609 missense probably damaging 1.00
R7288:Gal3st1 UTSW 11 3998651 missense probably damaging 0.98
R7290:Gal3st1 UTSW 11 3998093 missense possibly damaging 0.70
R7438:Gal3st1 UTSW 11 3998227 missense probably benign 0.00
R7934:Gal3st1 UTSW 11 3998405 missense probably damaging 1.00
R9046:Gal3st1 UTSW 11 3998278 missense probably benign 0.05
R9475:Gal3st1 UTSW 11 3998660 missense probably damaging 1.00
RF020:Gal3st1 UTSW 11 3998153 missense possibly damaging 0.75
Z1088:Gal3st1 UTSW 11 3997984 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TACTTTGGATCCGTGGTGCC -3'
(R):5'- AAGCTGGCGTTGAAGTGAC -3'

Sequencing Primer
(F):5'- CGCTCACCTGGAAGCTGTC -3'
(R):5'- ACGTCCAGCAGGTTCCAG -3'
Posted On 2019-05-15