Incidental Mutation 'R0597:Klra2'
ID55119
Institutional Source Beutler Lab
Gene Symbol Klra2
Ensembl Gene ENSMUSG00000030187
Gene Namekiller cell lectin-like receptor, subfamily A, member 2
SynonymsLy49b
MMRRC Submission 038786-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.049) question?
Stock #R0597 (G1)
Quality Score200
Status Validated
Chromosome6
Chromosomal Location131219223-131247362 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 131220185 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 251 (R251C)
Ref Sequence ENSEMBL: ENSMUSP00000032306 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032306] [ENSMUST00000088867]
Predicted Effect probably benign
Transcript: ENSMUST00000032306
AA Change: R251C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000032306
Gene: ENSMUSG00000030187
AA Change: R251C

DomainStartEndE-ValueType
CLECT 137 260 1.17e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000088867
AA Change: R284C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000086252
Gene: ENSMUSG00000030187
AA Change: R284C

DomainStartEndE-ValueType
CLECT 137 293 6.54e-6 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 99.0%
  • 10x: 97.4%
  • 20x: 94.1%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: The gene is a member of the large lectin-like type 2 transmembrane receptor family of the natural killer gene complex. The gene is located distantly telomeric to its family's gene cluster on chromosome 6. The gene differs from the other genes in its cluster as its promoter region contains long and short interspersed repetitive elements suggesting a possible rearrangement or gene conversion. It is unknown whether this gene's encoded protein is involved with natural killer cell differentiation as are its other family members. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy10 T C 1: 165,525,062 probably null Het
Anxa11 T C 14: 25,874,228 I221T probably damaging Het
Arhgap33 C G 7: 30,526,446 R565P probably damaging Het
Bmpr2 T C 1: 59,841,425 probably benign Het
Btn2a2 T A 13: 23,486,410 H51L probably benign Het
Casz1 T C 4: 148,944,394 S1099P probably benign Het
Cnot4 A G 6: 35,051,503 S393P possibly damaging Het
Cntnap5a T C 1: 116,184,461 probably benign Het
Cobl T C 11: 12,254,699 T586A probably benign Het
Crocc A G 4: 141,017,071 L1838P probably benign Het
Crocc T C 4: 141,019,913 K1528R probably benign Het
Dact2 A G 17: 14,197,041 V299A probably benign Het
Dapk1 C A 13: 60,761,384 N1270K probably benign Het
Ddx41 T C 13: 55,533,006 Y375C probably damaging Het
Dock5 T A 14: 67,784,934 probably null Het
Dyrk4 T G 6: 126,886,649 probably null Het
Eno1b T C 18: 48,047,739 I328T probably benign Het
Fam210b A G 2: 172,345,853 probably benign Het
Fbxl13 A G 5: 21,614,714 I229T probably benign Het
Fbxo39 A G 11: 72,316,921 D33G probably damaging Het
Fbxw11 A G 11: 32,720,496 E120G probably damaging Het
Fbxw2 A T 2: 34,811,020 L261Q probably damaging Het
Gm13084 G T 4: 143,812,652 N90K probably damaging Het
Gm5800 A C 14: 51,716,004 N51K probably benign Het
Gm6899 A G 11: 26,593,768 probably benign Het
Gm9745 C A 13: 8,940,766 probably benign Het
Gpx8 T C 13: 113,045,501 T133A possibly damaging Het
Grin3a C T 4: 49,665,351 V1095M probably damaging Het
Grip2 T C 6: 91,796,197 probably benign Het
Hacd4 A G 4: 88,437,520 F43L probably damaging Het
Hif1a T G 12: 73,942,275 S645R probably benign Het
Hipk3 A G 2: 104,433,637 S839P possibly damaging Het
Il16 A T 7: 83,677,975 probably benign Het
Il3ra T A 14: 14,351,166 probably null Het
Il5ra A G 6: 106,744,335 M1T probably null Het
Lamc2 C T 1: 153,133,621 V813M probably benign Het
Lbr A G 1: 181,832,213 V139A probably benign Het
Lrp5 T C 19: 3,600,777 D1219G possibly damaging Het
Map3k6 C T 4: 133,245,552 P341S possibly damaging Het
Mcts2 A G 2: 152,687,689 E140G probably benign Het
Med1 T C 11: 98,169,438 M222V probably benign Het
Mef2a G T 7: 67,235,148 S406* probably null Het
Muc19 A T 15: 91,900,502 noncoding transcript Het
Nr1h2 A G 7: 44,552,260 probably benign Het
Olfr1361 C A 13: 21,659,146 R59L probably damaging Het
Olfr205 A T 16: 59,328,760 F250I probably damaging Het
Olfr682-ps1 A G 7: 105,128,218 V73A possibly damaging Het
Olfr71 A T 4: 43,706,592 probably null Het
P4hb G A 11: 120,568,244 T141I possibly damaging Het
Polr3a A G 14: 24,484,134 V101A probably benign Het
Pou4f2 A G 8: 78,435,240 S245P probably benign Het
Rnpep A G 1: 135,272,419 V266A probably damaging Het
Scly G A 1: 91,309,833 G206R probably damaging Het
Sec14l3 A T 11: 4,074,814 K254N probably damaging Het
Sgpp1 A T 12: 75,735,100 I155N probably damaging Het
Slc22a14 A G 9: 119,172,124 L468P probably damaging Het
Slc22a27 A G 19: 7,865,884 F377L probably benign Het
Slc44a3 T C 3: 121,460,070 I625V probably benign Het
Slc47a2 A T 11: 61,309,976 I373N probably damaging Het
Slfn10-ps A T 11: 83,035,653 noncoding transcript Het
Smarcd1 T A 15: 99,711,094 I383N probably damaging Het
Sort1 A G 3: 108,338,910 D401G probably damaging Het
Sprr2a3 G T 3: 92,288,590 M1I probably null Het
Sycp2 A C 2: 178,356,580 V1049G possibly damaging Het
Tecrl T A 5: 83,354,928 K10* probably null Het
Tnpo3 A T 6: 29,578,565 C303* probably null Het
Vmn2r23 A G 6: 123,729,721 I503M probably benign Het
Zbtb8os T A 4: 129,346,877 I164N probably damaging Het
Zfp292 T C 4: 34,807,399 N1882D probably benign Het
Zfp91 T C 19: 12,770,095 I555V possibly damaging Het
Other mutations in Klra2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02271:Klra2 APN 6 131230217 missense probably benign 0.11
IGL02280:Klra2 APN 6 131245293 missense probably damaging 1.00
IGL02503:Klra2 APN 6 131230094 missense probably benign 0.10
IGL03120:Klra2 APN 6 131220217 missense probably benign 0.00
FR4449:Klra2 UTSW 6 131221846 frame shift probably null
FR4548:Klra2 UTSW 6 131221851 frame shift probably null
FR4737:Klra2 UTSW 6 131221852 frame shift probably null
R0082:Klra2 UTSW 6 131220247 missense possibly damaging 0.90
R0606:Klra2 UTSW 6 131220224 missense probably damaging 1.00
R0636:Klra2 UTSW 6 131220104 splice site probably benign
R0800:Klra2 UTSW 6 131230174 nonsense probably null
R1645:Klra2 UTSW 6 131243894 critical splice donor site probably null
R1655:Klra2 UTSW 6 131220211 missense probably damaging 0.96
R1950:Klra2 UTSW 6 131230115 missense probably benign 0.02
R2088:Klra2 UTSW 6 131242826 missense probably damaging 0.99
R2402:Klra2 UTSW 6 131243901 missense probably benign 0.01
R3776:Klra2 UTSW 6 131242963 missense probably benign 0.06
R4131:Klra2 UTSW 6 131228217 missense probably benign 0.03
R4570:Klra2 UTSW 6 131243937 missense probably damaging 1.00
R4585:Klra2 UTSW 6 131230157 missense probably benign 0.11
R4586:Klra2 UTSW 6 131230157 missense probably benign 0.11
R4884:Klra2 UTSW 6 131230202 missense probably damaging 1.00
R4982:Klra2 UTSW 6 131220189 missense probably benign 0.25
R5043:Klra2 UTSW 6 131220172 missense probably benign 0.06
R5457:Klra2 UTSW 6 131221889 missense possibly damaging 0.92
R6526:Klra2 UTSW 6 131221876 missense probably benign 0.21
R6538:Klra2 UTSW 6 131242990 missense probably damaging 0.99
R7393:Klra2 UTSW 6 131230202 missense probably damaging 1.00
R7785:Klra2 UTSW 6 131245290 missense possibly damaging 0.95
RF020:Klra2 UTSW 6 131221838 frame shift probably null
RF059:Klra2 UTSW 6 131221838 frame shift probably null
RF064:Klra2 UTSW 6 131221839 frame shift probably null
Z1088:Klra2 UTSW 6 131228290 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCCTGCTCTGTTAAGTCTGTTGTCAAA -3'
(R):5'- GTCACAGAAGATCCCTGTGTGCC -3'

Sequencing Primer
(F):5'- TGTTAAGTCTGTTGTCAAAACATTTC -3'
(R):5'- tgtatgggcacatgtcacag -3'
Posted On2013-07-11