Incidental Mutation 'R0597:Nr1h2'
ID55121
Institutional Source Beutler Lab
Gene Symbol Nr1h2
Ensembl Gene ENSMUSG00000060601
Gene Namenuclear receptor subfamily 1, group H, member 2
SynonymsRIP15, LXRB, Unr2, LXRbeta
MMRRC Submission 038786-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.709) question?
Stock #R0597 (G1)
Quality Score218
Status Validated
Chromosome7
Chromosomal Location44549616-44553951 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 44552260 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146826 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049343] [ENSMUST00000073488] [ENSMUST00000107910] [ENSMUST00000107911] [ENSMUST00000107912] [ENSMUST00000128600] [ENSMUST00000142298] [ENSMUST00000145956] [ENSMUST00000151793] [ENSMUST00000167197] [ENSMUST00000207737] [ENSMUST00000208366] [ENSMUST00000209017]
Predicted Effect probably benign
Transcript: ENSMUST00000049343
SMART Domains Protein: ENSMUSP00000039776
Gene: ENSMUSG00000038644

DomainStartEndE-ValueType
coiled coil region 34 58 N/A INTRINSIC
Blast:POLBc 65 108 1e-7 BLAST
low complexity region 212 225 N/A INTRINSIC
Blast:POLBc 227 279 1e-19 BLAST
POLBc 306 763 2.53e-161 SMART
Blast:POLBc 790 837 1e-18 BLAST
Pfam:zf-C4pol 1010 1080 5.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073488
SMART Domains Protein: ENSMUSP00000073188
Gene: ENSMUSG00000060601

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
ZnF_C4 75 148 5.81e-32 SMART
low complexity region 153 188 N/A INTRINSIC
low complexity region 190 202 N/A INTRINSIC
HOLI 258 417 2.08e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107910
SMART Domains Protein: ENSMUSP00000103543
Gene: ENSMUSG00000060601

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
ZnF_C4 72 145 5.81e-32 SMART
low complexity region 150 185 N/A INTRINSIC
low complexity region 187 199 N/A INTRINSIC
HOLI 255 414 2.08e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107911
SMART Domains Protein: ENSMUSP00000103544
Gene: ENSMUSG00000060601

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
ZnF_C4 72 145 5.81e-32 SMART
low complexity region 150 185 N/A INTRINSIC
low complexity region 187 199 N/A INTRINSIC
HOLI 255 414 2.08e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107912
SMART Domains Protein: ENSMUSP00000103545
Gene: ENSMUSG00000060601

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
ZnF_C4 75 148 5.81e-32 SMART
low complexity region 153 188 N/A INTRINSIC
low complexity region 190 202 N/A INTRINSIC
HOLI 258 417 2.08e-42 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123358
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128354
Predicted Effect probably benign
Transcript: ENSMUST00000128600
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132769
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136611
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137674
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138746
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141901
Predicted Effect probably benign
Transcript: ENSMUST00000142298
Predicted Effect probably benign
Transcript: ENSMUST00000145956
SMART Domains Protein: ENSMUSP00000117844
Gene: ENSMUSG00000038644

DomainStartEndE-ValueType
coiled coil region 34 58 N/A INTRINSIC
Blast:POLBc 65 108 2e-8 BLAST
PDB:3IAY|A 76 151 7e-8 PDB
SCOP:d1tgoa1 117 153 3e-10 SMART
Blast:POLBc 130 153 7e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000151793
SMART Domains Protein: ENSMUSP00000117157
Gene: ENSMUSG00000038644

DomainStartEndE-ValueType
coiled coil region 34 58 N/A INTRINSIC
Blast:POLBc 66 108 1e-7 BLAST
low complexity region 212 225 N/A INTRINSIC
Blast:POLBc 227 279 1e-19 BLAST
POLBc 306 763 7.8e-164 SMART
Blast:POLBc 790 837 1e-18 BLAST
low complexity region 914 938 N/A INTRINSIC
low complexity region 959 980 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167197
SMART Domains Protein: ENSMUSP00000126788
Gene: ENSMUSG00000060601

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
ZnF_C4 75 148 5.81e-32 SMART
low complexity region 153 188 N/A INTRINSIC
low complexity region 190 202 N/A INTRINSIC
HOLI 258 417 2.08e-42 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207550
Predicted Effect probably benign
Transcript: ENSMUST00000207737
Predicted Effect probably benign
Transcript: ENSMUST00000208322
Predicted Effect probably benign
Transcript: ENSMUST00000208366
Predicted Effect probably benign
Transcript: ENSMUST00000209017
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 99.0%
  • 10x: 97.4%
  • 20x: 94.1%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The liver X receptors, LXRA (NR1H3; MIM 602423) and LXRB, form a subfamily of the nuclear receptor superfamily and are key regulators of macrophage function, controlling transcriptional programs involved in lipid homeostasis and inflammation. The inducible LXRA is highly expressed in liver, adrenal gland, intestine, adipose tissue, macrophages, lung, and kidney, whereas LXRB is ubiquitously expressed. Ligand-activated LXRs form obligate heterodimers with retinoid X receptors (RXRs; see MIM 180245) and regulate expression of target genes containing LXR response elements (summary by Korf et al., 2009 [PubMed 19436111]).[supplied by OMIM, Jan 2010]
PHENOTYPE: Homozygous null mutations cause altered lipid, cholesterol and glucose metabolism and may lead to elevated cartilage matrix catabolism and PGE2 production, lipid-laden uterus myocytes and Sertoli cells, impaired uterus contractility and parturition, and higher susceptibility to bacterial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy10 T C 1: 165,525,062 probably null Het
Anxa11 T C 14: 25,874,228 I221T probably damaging Het
Arhgap33 C G 7: 30,526,446 R565P probably damaging Het
Bmpr2 T C 1: 59,841,425 probably benign Het
Btn2a2 T A 13: 23,486,410 H51L probably benign Het
Casz1 T C 4: 148,944,394 S1099P probably benign Het
Cnot4 A G 6: 35,051,503 S393P possibly damaging Het
Cntnap5a T C 1: 116,184,461 probably benign Het
Cobl T C 11: 12,254,699 T586A probably benign Het
Crocc A G 4: 141,017,071 L1838P probably benign Het
Crocc T C 4: 141,019,913 K1528R probably benign Het
Dact2 A G 17: 14,197,041 V299A probably benign Het
Dapk1 C A 13: 60,761,384 N1270K probably benign Het
Ddx41 T C 13: 55,533,006 Y375C probably damaging Het
Dock5 T A 14: 67,784,934 probably null Het
Dyrk4 T G 6: 126,886,649 probably null Het
Eno1b T C 18: 48,047,739 I328T probably benign Het
Fam210b A G 2: 172,345,853 probably benign Het
Fbxl13 A G 5: 21,614,714 I229T probably benign Het
Fbxo39 A G 11: 72,316,921 D33G probably damaging Het
Fbxw11 A G 11: 32,720,496 E120G probably damaging Het
Fbxw2 A T 2: 34,811,020 L261Q probably damaging Het
Gm13084 G T 4: 143,812,652 N90K probably damaging Het
Gm5800 A C 14: 51,716,004 N51K probably benign Het
Gm6899 A G 11: 26,593,768 probably benign Het
Gm9745 C A 13: 8,940,766 probably benign Het
Gpx8 T C 13: 113,045,501 T133A possibly damaging Het
Grin3a C T 4: 49,665,351 V1095M probably damaging Het
Grip2 T C 6: 91,796,197 probably benign Het
Hacd4 A G 4: 88,437,520 F43L probably damaging Het
Hif1a T G 12: 73,942,275 S645R probably benign Het
Hipk3 A G 2: 104,433,637 S839P possibly damaging Het
Il16 A T 7: 83,677,975 probably benign Het
Il3ra T A 14: 14,351,166 probably null Het
Il5ra A G 6: 106,744,335 M1T probably null Het
Klra2 G A 6: 131,220,185 R251C probably benign Het
Lamc2 C T 1: 153,133,621 V813M probably benign Het
Lbr A G 1: 181,832,213 V139A probably benign Het
Lrp5 T C 19: 3,600,777 D1219G possibly damaging Het
Map3k6 C T 4: 133,245,552 P341S possibly damaging Het
Mcts2 A G 2: 152,687,689 E140G probably benign Het
Med1 T C 11: 98,169,438 M222V probably benign Het
Mef2a G T 7: 67,235,148 S406* probably null Het
Muc19 A T 15: 91,900,502 noncoding transcript Het
Olfr1361 C A 13: 21,659,146 R59L probably damaging Het
Olfr205 A T 16: 59,328,760 F250I probably damaging Het
Olfr682-ps1 A G 7: 105,128,218 V73A possibly damaging Het
Olfr71 A T 4: 43,706,592 probably null Het
P4hb G A 11: 120,568,244 T141I possibly damaging Het
Polr3a A G 14: 24,484,134 V101A probably benign Het
Pou4f2 A G 8: 78,435,240 S245P probably benign Het
Rnpep A G 1: 135,272,419 V266A probably damaging Het
Scly G A 1: 91,309,833 G206R probably damaging Het
Sec14l3 A T 11: 4,074,814 K254N probably damaging Het
Sgpp1 A T 12: 75,735,100 I155N probably damaging Het
Slc22a14 A G 9: 119,172,124 L468P probably damaging Het
Slc22a27 A G 19: 7,865,884 F377L probably benign Het
Slc44a3 T C 3: 121,460,070 I625V probably benign Het
Slc47a2 A T 11: 61,309,976 I373N probably damaging Het
Slfn10-ps A T 11: 83,035,653 noncoding transcript Het
Smarcd1 T A 15: 99,711,094 I383N probably damaging Het
Sort1 A G 3: 108,338,910 D401G probably damaging Het
Sprr2a3 G T 3: 92,288,590 M1I probably null Het
Sycp2 A C 2: 178,356,580 V1049G possibly damaging Het
Tecrl T A 5: 83,354,928 K10* probably null Het
Tnpo3 A T 6: 29,578,565 C303* probably null Het
Vmn2r23 A G 6: 123,729,721 I503M probably benign Het
Zbtb8os T A 4: 129,346,877 I164N probably damaging Het
Zfp292 T C 4: 34,807,399 N1882D probably benign Het
Zfp91 T C 19: 12,770,095 I555V possibly damaging Het
Other mutations in Nr1h2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02211:Nr1h2 APN 7 44550460 missense probably damaging 1.00
IGL02327:Nr1h2 APN 7 44551500 unclassified probably benign
bisogno UTSW 7 44550013 missense probably damaging 1.00
quiero UTSW 7 44552537 missense probably benign 0.27
R0179:Nr1h2 UTSW 7 44552265 intron probably null
R0433:Nr1h2 UTSW 7 44549987 makesense probably null
R2432:Nr1h2 UTSW 7 44551367 missense possibly damaging 0.46
R4635:Nr1h2 UTSW 7 44552537 missense probably benign 0.27
R4662:Nr1h2 UTSW 7 44550431 missense probably damaging 1.00
R4675:Nr1h2 UTSW 7 44552555 missense possibly damaging 0.66
R4782:Nr1h2 UTSW 7 44550499 missense possibly damaging 0.93
R5064:Nr1h2 UTSW 7 44551649 missense possibly damaging 0.82
R5191:Nr1h2 UTSW 7 44550416 missense probably damaging 1.00
R6266:Nr1h2 UTSW 7 44552052 nonsense probably null
R6933:Nr1h2 UTSW 7 44550013 missense probably damaging 1.00
R7323:Nr1h2 UTSW 7 44550322 missense possibly damaging 0.65
R7577:Nr1h2 UTSW 7 44550792 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAGAAGCCTTTGCAGCCTTCAC -3'
(R):5'- GTTGGAGAAGCTCACTGTCCTGTC -3'

Sequencing Primer
(F):5'- GTTGTAGTGGAAGCCCGAA -3'
(R):5'- CTAGGGAATGGTTCTCCTCAGC -3'
Posted On2013-07-11