Mutagenetix > Incidental Mutation

Incidental Mutation 'R7107:Lrrk1'

551243

Institutional Source

Beutler Lab

Gene Symbol

Lrrk1

Ensembl Gene

ENSMUSG00000015133

Gene Name

leucine-rich repeat kinase 1

Synonyms

MMRRC Submission

045199-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7107 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

66226912-66388350 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 66287443 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 987 (D987V)

Ref Sequence

ENSEMBL: ENSMUSP00000015277 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015277]

AlphaFold

Q3UHC2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000015277
AA Change: D987V

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000015277
Gene: ENSMUSG00000015133
AA Change: D987V

Domain	Start	End	E-Value	Type
ANK	86	116	9.33e2	SMART
ANK	119	148	1.14e2	SMART
ANK	152	182	8.36e1	SMART
ANK	193	223	2.6e1	SMART
LRR	278	300	2.84e2	SMART
LRR	301	325	7.79e0	SMART
LRR	328	351	3.27e1	SMART
LRR_TYP	379	401	2.53e-2	SMART
LRR	403	427	5.89e1	SMART
LRR	472	493	5.27e1	SMART
LRR	548	569	2.92e2	SMART
LRR	570	594	5.88e0	SMART
Pfam:Arf	625	786	2e-8	PFAM
Pfam:Roc	640	761	3.1e-24	PFAM
Pfam:Ras	640	782	2.2e-7	PFAM
Pfam:COR	844	1046	4.7e-26	PFAM
low complexity region	1109	1119	N/A	INTRINSIC
low complexity region	1209	1222	N/A	INTRINSIC
Pfam:Pkinase	1243	1521	7.8e-40	PFAM
Pfam:Pkinase_Tyr	1244	1520	9.4e-39	PFAM
low complexity region	1642	1654	N/A	INTRINSIC
low complexity region	1839	1846	N/A	INTRINSIC
low complexity region	1852	1871	N/A	INTRINSIC
low complexity region	1957	1970	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

99% (78/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain protein that is a leucine-rich repeat kinase and a GDP/GTP binding protein. The encoded protein is thought to play a role in the regulation of bone mass. Mice lacking a similar gene showed severe osteopetrosis, increased bone mineralization and decreased bone resorption. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality. Mice homozygous for another knock-out allele exhibit severe osteopetrosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	T	A	13: 59,742,183	R608*	probably null	Het
4922502D21Rik	A	G	6: 129,322,952	C188R	probably damaging	Het
Abca8b	A	G	11: 109,976,473	L253S	probably damaging	Het
Adgrv1	T	C	13: 81,578,142	E588G	probably benign	Het
Ahcy	G	A	2: 155,068,973	A25V	probably damaging	Het
Ank2	A	C	3: 127,003,982	L710R	probably damaging	Het
Ap1b1	A	G	11: 5,039,558	T824A	probably benign	Het
Arap2	T	A	5: 62,606,208	H1531L	probably damaging	Het
B3gnt7	T	C	1: 86,305,773	L247P	probably damaging	Het
Bcl6b	A	G	11: 70,226,570	C409R	probably damaging	Het
Bicdl1	T	C	5: 115,670,170	H301R	probably benign	Het
Casc3	T	A	11: 98,827,587	I491N	possibly damaging	Het
Ccdc92b	T	A	11: 74,630,061	L63Q	probably damaging	Het
Cep250	A	G	2: 155,995,394	T2319A	probably benign	Het
Chd1	T	C	17: 15,761,366	S1356P	probably damaging	Het
Chd8	A	G	14: 52,212,672	S1542P	probably benign	Het
Cntnap4	A	G	8: 112,815,488	D751G	probably damaging	Het
Cpsf4l	G	A	11: 113,702,489	R90C	possibly damaging	Het
Defa21	G	A	8: 21,025,708	A41T	probably damaging	Het
Dennd4a	G	T	9: 64,894,399	L941F	possibly damaging	Het
Dnah12	G	A	14: 26,778,912		probably null	Het
Dtx4	A	T	19: 12,473,260	C529*	probably null	Het
Entpd3	A	G	9: 120,560,599	Y317C	probably damaging	Het
Erp29	T	A	5: 121,445,318	I182F	possibly damaging	Het
Fam161a	A	G	11: 23,023,452	R445G	possibly damaging	Het
Fam214b	A	T	4: 43,036,434	V99E	probably benign	Het
Fam76a	T	A	4: 132,903,921	M238L	possibly damaging	Het
Fn1	T	C	1: 71,627,249	Y875C	probably damaging	Het
Gnb2	A	G	5: 137,530,182		probably null	Het
Hspg2	T	C	4: 137,510,652	S229P	probably damaging	Het
Ighv6-6	A	G	12: 114,434,970	S59P	probably damaging	Het
Itpkc	C	A	7: 27,228,277	A71S	probably benign	Het
Kcnk10	G	A	12: 98,518,743	R45*	probably null	Het
Krcc1	A	G	6: 71,284,214	S77G	probably benign	Het
Lelp1	G	A	3: 92,135,514	T76I	unknown	Het
Lifr	A	T	15: 7,178,940	I600F	possibly damaging	Het
Mfsd7a	T	A	5: 108,448,715		probably null	Het
Muc16	C	T	9: 18,637,298	D5900N	probably benign	Het
Muc6	AGGCGCAGAAACCCTGGC	AGGC	7: 141,634,450		probably null	Het
Myo9a	A	G	9: 59,870,815	I1285V	probably benign	Het
Ndel1	T	C	11: 68,822,648	D321G	possibly damaging	Het
Nlrp4b	T	C	7: 10,715,217	V449A	probably damaging	Het
Olfr1386	T	A	11: 49,470,434	Y94*	probably null	Het
Olfr1495	A	G	19: 13,769,161	E273G	probably benign	Het
Olfr195	A	C	16: 59,148,916	D22A	probably benign	Het
Olfr458	T	C	6: 42,460,554	N155S	possibly damaging	Het
Olfr639	A	T	7: 104,012,282	L140Q	probably benign	Het
Osbpl1a	G	A	18: 12,841,253	R459*	probably null	Het
Pabpc1l	A	C	2: 164,042,479	T379P	probably damaging	Het
Pde2a	A	T	7: 101,421,968	Q15L	probably benign	Het
Pdk1	A	G	2: 71,895,741	N331S	probably benign	Het
Pfdn1	A	T	18: 36,451,466		probably null	Het
Pnliprp1	T	A	19: 58,729,150	L9H	probably damaging	Het
Prl7a2	A	T	13: 27,659,093	D242E	possibly damaging	Het
Prmt9	T	A	8: 77,568,251	I408N	possibly damaging	Het
Psme4	G	A	11: 30,848,105	R1366H	probably benign	Het
Pstpip1	A	T	9: 56,128,650	D393V	probably damaging	Het
Rab5b	A	G	10: 128,683,193		probably null	Het
Rap1gap2	G	A	11: 74,393,119	R618C	probably damaging	Het
Rin1	A	G	19: 5,050,773		probably benign	Het
Sall3	G	A	18: 80,973,754	P320S	probably benign	Het
Sdk1	A	G	5: 142,081,716	T1124A	probably damaging	Het
Sirpb1c	T	A	3: 15,838,777	T88S	possibly damaging	Het
Slc35f6	T	A	5: 30,656,777	I189N	probably damaging	Het
Spsb2	A	T	6: 124,810,281	Q226L	probably benign	Het
Stab2	T	C	10: 86,905,592	D1221G	possibly damaging	Het
Sugp1	G	A	8: 70,070,150	R500H	probably benign	Het
Syne1	A	G	10: 5,132,078	Y849H	probably damaging	Het
Tbck	T	A	3: 132,722,331	I249N	possibly damaging	Het
Tdrd6	A	C	17: 43,624,204	F1984L	probably benign	Het
Tnxb	T	A	17: 34,671,340	V219E	unknown	Het
Tpst1	T	A	5: 130,114,503	V294D	probably damaging	Het
Treml1	A	G	17: 48,360,219	Q44R	probably damaging	Het
Trrap	G	A	5: 144,797,135	A933T	probably benign	Het
Vars2	A	G	17: 35,658,250	L853P	probably damaging	Het
Vmn1r10	A	T	6: 57,113,630	N69I	possibly damaging	Het
Vmn1r179	T	A	7: 23,928,394	Y3*	probably null	Het
Vmn2r38	T	A	7: 9,090,729	Y498F	probably benign	Het
Zc3h11a	T	C	1: 133,638,917	T179A	probably damaging	Het
Zmym2	A	G	14: 56,902,712	T3A	probably benign	Het

Other mutations in Lrrk1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01365:Lrrk1	APN	7	66287701	missense	probably damaging	1.00
IGL01511:Lrrk1	APN	7	66265450	missense	possibly damaging	0.48
IGL02337:Lrrk1	APN	7	66279416	missense	possibly damaging	0.92
IGL02636:Lrrk1	APN	7	66308659	critical splice donor site	probably null
IGL02679:Lrrk1	APN	7	66274872	missense	probably damaging	1.00
IGL02711:Lrrk1	APN	7	66330767	missense	probably damaging	1.00
IGL02742:Lrrk1	APN	7	66308691	missense	probably benign	0.12
IGL02878:Lrrk1	APN	7	66262563	missense	probably benign
IGL03135:Lrrk1	APN	7	66262890	missense	probably benign	0.00
IGL03191:Lrrk1	APN	7	66259959	missense	probably damaging	0.99
IGL03198:Lrrk1	APN	7	66306894	missense	probably damaging	1.00
combustion	UTSW	7	66262665	missense	possibly damaging	0.94
fluorine	UTSW	7	66302710	missense	possibly damaging	0.89
halide	UTSW	7	66265474	missense	possibly damaging	0.82
Heiland	UTSW	7	66262733	missense	probably damaging	0.96
liebster	UTSW	7	66294981	missense	probably damaging	1.00
magi	UTSW	7	66281648	missense	probably damaging	1.00
oxidation	UTSW	7	66279372	missense	probably benign	0.00
phlogiston	UTSW	7	66278520	splice site	probably benign
Savior	UTSW	7	66262487	missense	probably damaging	1.00
wenig	UTSW	7	66273001	missense	probably damaging	1.00
R0105:Lrrk1	UTSW	7	66292341	missense	probably damaging	1.00
R0105:Lrrk1	UTSW	7	66292341	missense	probably damaging	1.00
R0276:Lrrk1	UTSW	7	66296263	splice site	probably benign
R0505:Lrrk1	UTSW	7	66290908	splice site	probably null
R0609:Lrrk1	UTSW	7	66266615	splice site	probably null
R0650:Lrrk1	UTSW	7	66292336	missense	probably damaging	1.00
R0676:Lrrk1	UTSW	7	66294981	missense	probably damaging	1.00
R1157:Lrrk1	UTSW	7	66262283	missense	probably benign	0.00
R1435:Lrrk1	UTSW	7	66273028	missense	probably damaging	1.00
R1468:Lrrk1	UTSW	7	66259974	missense	probably damaging	1.00
R1468:Lrrk1	UTSW	7	66259974	missense	probably damaging	1.00
R1498:Lrrk1	UTSW	7	66302671	nonsense	probably null
R1620:Lrrk1	UTSW	7	66381538	missense	probably benign	0.00
R1884:Lrrk1	UTSW	7	66262437	missense	probably benign
R1891:Lrrk1	UTSW	7	66279300	missense	probably damaging	1.00
R1989:Lrrk1	UTSW	7	66281684	missense	probably damaging	1.00
R2107:Lrrk1	UTSW	7	66279282	missense	probably damaging	1.00
R2140:Lrrk1	UTSW	7	66330750	missense	probably damaging	1.00
R2144:Lrrk1	UTSW	7	66296163	missense	probably damaging	0.98
R2147:Lrrk1	UTSW	7	66285411	splice site	probably null
R3176:Lrrk1	UTSW	7	66305521	missense	possibly damaging	0.69
R3276:Lrrk1	UTSW	7	66305521	missense	possibly damaging	0.69
R3886:Lrrk1	UTSW	7	66292364	missense	probably damaging	1.00
R3893:Lrrk1	UTSW	7	66278520	splice site	probably benign
R3906:Lrrk1	UTSW	7	66294903	missense	possibly damaging	0.84
R4259:Lrrk1	UTSW	7	66330764	missense	probably damaging	1.00
R4649:Lrrk1	UTSW	7	66273053	missense	probably benign	0.12
R4653:Lrrk1	UTSW	7	66273053	missense	probably benign	0.12
R4672:Lrrk1	UTSW	7	66279372	missense	probably benign	0.00
R4693:Lrrk1	UTSW	7	66262487	missense	probably damaging	1.00
R4729:Lrrk1	UTSW	7	66262293	missense	probably benign
R4737:Lrrk1	UTSW	7	66306873	missense	probably benign	0.09
R4795:Lrrk1	UTSW	7	66262665	missense	possibly damaging	0.94
R4911:Lrrk1	UTSW	7	66295454	missense	probably damaging	0.97
R5002:Lrrk1	UTSW	7	66332363	missense	probably damaging	1.00
R5254:Lrrk1	UTSW	7	66307107	missense	probably benign	0.00
R5407:Lrrk1	UTSW	7	66270797	missense	probably benign	0.20
R5482:Lrrk1	UTSW	7	66330670	missense	probably benign
R5600:Lrrk1	UTSW	7	66307215	missense	probably benign	0.31
R5615:Lrrk1	UTSW	7	66287615	missense	probably damaging	1.00
R6041:Lrrk1	UTSW	7	66262133	missense	probably benign
R6211:Lrrk1	UTSW	7	66302710	missense	possibly damaging	0.89
R6271:Lrrk1	UTSW	7	66307103	critical splice donor site	probably null
R6276:Lrrk1	UTSW	7	66306839	splice site	probably null
R6447:Lrrk1	UTSW	7	66302728	missense	probably benign	0.19
R6478:Lrrk1	UTSW	7	66262733	missense	probably damaging	0.96
R6615:Lrrk1	UTSW	7	66281648	missense	probably damaging	1.00
R6745:Lrrk1	UTSW	7	66273001	missense	probably damaging	1.00
R6836:Lrrk1	UTSW	7	66342779	missense	probably benign	0.05
R6995:Lrrk1	UTSW	7	66292342	missense	probably damaging	1.00
R7137:Lrrk1	UTSW	7	66285279	missense	probably benign	0.06
R7203:Lrrk1	UTSW	7	66270825	missense	probably damaging	1.00
R7224:Lrrk1	UTSW	7	66332386	missense	probably damaging	0.99
R7239:Lrrk1	UTSW	7	66262155	missense	probably benign
R7440:Lrrk1	UTSW	7	66290854	missense	probably damaging	1.00
R7515:Lrrk1	UTSW	7	66262562	missense	probably benign
R7593:Lrrk1	UTSW	7	66308691	missense	probably benign	0.12
R7728:Lrrk1	UTSW	7	66262715	missense	probably benign	0.00
R7984:Lrrk1	UTSW	7	66300729	splice site	probably null
R7993:Lrrk1	UTSW	7	66262454	missense	probably benign	0.00
R8009:Lrrk1	UTSW	7	66265474	missense	possibly damaging	0.82
R8037:Lrrk1	UTSW	7	66285341	missense	probably benign
R8101:Lrrk1	UTSW	7	66342782	missense	probably benign
R8116:Lrrk1	UTSW	7	66262623	missense	possibly damaging	0.95
R8126:Lrrk1	UTSW	7	66292315	missense	probably damaging	1.00
R8278:Lrrk1	UTSW	7	66278684	missense	probably benign	0.37
R8559:Lrrk1	UTSW	7	66282327	missense	possibly damaging	0.48
R8669:Lrrk1	UTSW	7	66262596	missense	probably benign	0.20
R8690:Lrrk1	UTSW	7	66302729	missense	probably benign	0.02
R8955:Lrrk1	UTSW	7	66269825	missense	probably benign	0.09
R9135:Lrrk1	UTSW	7	66278609	missense	probably damaging	1.00
R9380:Lrrk1	UTSW	7	66278583	missense	probably damaging	1.00
R9625:Lrrk1	UTSW	7	66259918	makesense	probably null
R9721:Lrrk1	UTSW	7	66274875	missense	probably damaging	1.00
RF018:Lrrk1	UTSW	7	66381502	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- TTTTCCAACTGCCCCAAGAG -3'
(R):5'- TCTGAATGCCTGCAGAGGATC -3'

Sequencing Primer
(F):5'- GTAGCCCATGACACCAGATATGG -3'
(R):5'- GGATCTTTAACATCAAGGGCTCGC -3'

Posted On

2019-05-15