Mutagenetix > Incidental Mutations

Incidental Mutation 'R7107:Cntnap4'

551250

Institutional Source

Beutler Lab

Gene Symbol

Cntnap4

Ensembl Gene

ENSMUSG00000031772

Gene Name

contactin associated protein-like 4

Synonyms

E130114F09Rik, Caspr4

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.094) question?

Stock #

R7107 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

112570043-112882717 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 112815488 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 751 (D751G)

Ref Sequence

ENSEMBL: ENSMUSP00000034225 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034225] [ENSMUST00000118171]

Predicted Effect

probably damaging
Transcript: ENSMUST00000034225
AA Change: D751G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000034225
Gene: ENSMUSG00000031772
AA Change: D751G

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
FA58C	32	179	2.35e-19	SMART
LamG	206	343	5.14e-25	SMART
LamG	392	526	1.04e-25	SMART
EGF	554	588	1.4e0	SMART
Blast:FBG	591	775	1e-120	BLAST
LamG	815	942	1.01e-32	SMART
EGF	963	999	1.36e1	SMART
LamG	1040	1178	7.8e-16	SMART
transmembrane domain	1244	1266	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000118171
AA Change: D751G

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000112511
Gene: ENSMUSG00000031772
AA Change: D751G

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
FA58C	32	179	2.35e-19	SMART
LamG	206	343	5.14e-25	SMART
LamG	392	526	1.04e-25	SMART
EGF	554	588	1.4e0	SMART
Blast:FBG	591	775	1e-120	BLAST
LamG	815	942	1.01e-32	SMART
EGF	963	999	1.36e1	SMART
LamG	1040	1178	2.06e-15	SMART
transmembrane domain	1244	1266	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125976

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

99% (78/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin protein family. Members of this family function in the vertebrate nervous system as cell adhesion molecules and receptors. This protein contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, and thrombospondin N-terminal-like domains. This protein may also play a role in proper neurotransmission in the dopaminergic and GABAergic systems and mutations in this gene may be associated with certain psychiatric illnesses. A polymorphism in an intron of this gene may be associated with longevity. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous knock-out mice show increased midbrain dopaminergic release in the nucleus accumbens, synaptic defects, impaired sensory-motor gating, and increased grooming behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	T	A	13: 59,742,183	R608*	probably null	Het
4922502D21Rik	A	G	6: 129,322,952	C188R	probably damaging	Het
Abca8b	A	G	11: 109,976,473	L253S	probably damaging	Het
Adgrv1	T	C	13: 81,578,142	E588G	probably benign	Het
Ahcy	G	A	2: 155,068,973	A25V	probably damaging	Het
Ank2	A	C	3: 127,003,982	L710R	probably damaging	Het
Ap1b1	A	G	11: 5,039,558	T824A	probably benign	Het
Arap2	T	A	5: 62,606,208	H1531L	probably damaging	Het
B3gnt7	T	C	1: 86,305,773	L247P	probably damaging	Het
Bcl6b	A	G	11: 70,226,570	C409R	probably damaging	Het
Bicdl1	T	C	5: 115,670,170	H301R	probably benign	Het
Casc3	T	A	11: 98,827,587	I491N	possibly damaging	Het
Ccdc92b	T	A	11: 74,630,061	L63Q	probably damaging	Het
Cep250	A	G	2: 155,995,394	T2319A	probably benign	Het
Chd1	T	C	17: 15,761,366	S1356P	probably damaging	Het
Chd8	A	G	14: 52,212,672	S1542P	probably benign	Het
Cpsf4l	G	A	11: 113,702,489	R90C	possibly damaging	Het
Defa21	G	A	8: 21,025,708	A41T	probably damaging	Het
Dennd4a	G	T	9: 64,894,399	L941F	possibly damaging	Het
Dnah12	G	A	14: 26,778,912		probably null	Het
Dtx4	A	T	19: 12,473,260	C529*	probably null	Het
Entpd3	A	G	9: 120,560,599	Y317C	probably damaging	Het
Erp29	T	A	5: 121,445,318	I182F	possibly damaging	Het
Fam161a	A	G	11: 23,023,452	R445G	possibly damaging	Het
Fam214b	A	T	4: 43,036,434	V99E	probably benign	Het
Fam76a	T	A	4: 132,903,921	M238L	possibly damaging	Het
Fn1	T	C	1: 71,627,249	Y875C	probably damaging	Het
Gnb2	A	G	5: 137,530,182		probably null	Het
Hspg2	T	C	4: 137,510,652	S229P	probably damaging	Het
Ighv6-6	A	G	12: 114,434,970	S59P	probably damaging	Het
Itpkc	C	A	7: 27,228,277	A71S	probably benign	Het
Kcnk10	G	A	12: 98,518,743	R45*	probably null	Het
Krcc1	A	G	6: 71,284,214	S77G	probably benign	Het
Lelp1	G	A	3: 92,135,514	T76I	unknown	Het
Lifr	A	T	15: 7,178,940	I600F	possibly damaging	Het
Lrrk1	T	A	7: 66,287,443	D987V	possibly damaging	Het
Mfsd7a	T	A	5: 108,448,715		probably null	Het
Muc16	C	T	9: 18,637,298	D5900N	probably benign	Het
Muc6	AGGCGCAGAAACCCTGGC	AGGC	7: 141,634,450		probably null	Het
Myo9a	A	G	9: 59,870,815	I1285V	probably benign	Het
Ndel1	T	C	11: 68,822,648	D321G	possibly damaging	Het
Nlrp4b	T	C	7: 10,715,217	V449A	probably damaging	Het
Olfr1386	T	A	11: 49,470,434	Y94*	probably null	Het
Olfr1495	A	G	19: 13,769,161	E273G	probably benign	Het
Olfr195	A	C	16: 59,148,916	D22A	probably benign	Het
Olfr458	T	C	6: 42,460,554	N155S	possibly damaging	Het
Olfr639	A	T	7: 104,012,282	L140Q	probably benign	Het
Osbpl1a	G	A	18: 12,841,253	R459*	probably null	Het
Pabpc1l	A	C	2: 164,042,479	T379P	probably damaging	Het
Pde2a	A	T	7: 101,421,968	Q15L	probably benign	Het
Pdk1	A	G	2: 71,895,741	N331S	probably benign	Het
Pfdn1	A	T	18: 36,451,466		probably null	Het
Pnliprp1	T	A	19: 58,729,150	L9H	probably damaging	Het
Prl7a2	A	T	13: 27,659,093	D242E	possibly damaging	Het
Prmt9	T	A	8: 77,568,251	I408N	possibly damaging	Het
Psme4	G	A	11: 30,848,105	R1366H	probably benign	Het
Pstpip1	A	T	9: 56,128,650	D393V	probably damaging	Het
Rab5b	A	G	10: 128,683,193		probably null	Het
Rap1gap2	G	A	11: 74,393,119	R618C	probably damaging	Het
Rin1	A	G	19: 5,050,773		probably benign	Het
Sall3	G	A	18: 80,973,754	P320S	probably benign	Het
Sdk1	A	G	5: 142,081,716	T1124A	probably damaging	Het
Sirpb1c	T	A	3: 15,838,777	T88S	possibly damaging	Het
Slc35f6	T	A	5: 30,656,777	I189N	probably damaging	Het
Spsb2	A	T	6: 124,810,281	Q226L	probably benign	Het
Stab2	T	C	10: 86,905,592	D1221G	possibly damaging	Het
Sugp1	G	A	8: 70,070,150	R500H	probably benign	Het
Syne1	A	G	10: 5,132,078	Y849H	probably damaging	Het
Tbck	T	A	3: 132,722,331	I249N	possibly damaging	Het
Tdrd6	A	C	17: 43,624,204	F1984L	probably benign	Het
Tnxb	T	A	17: 34,671,340	V219E	unknown	Het
Tpst1	T	A	5: 130,114,503	V294D	probably damaging	Het
Treml1	A	G	17: 48,360,219	Q44R	probably damaging	Het
Trrap	G	A	5: 144,797,135	A933T	probably benign	Het
Vars2	A	G	17: 35,658,250	L853P	probably damaging	Het
Vmn1r10	A	T	6: 57,113,630	N69I	possibly damaging	Het
Vmn1r179	T	A	7: 23,928,394	Y3*	probably null	Het
Vmn2r38	T	A	7: 9,090,729	Y498F	probably benign	Het
Zc3h11a	T	C	1: 133,638,917	T179A	probably damaging	Het
Zmym2	A	G	14: 56,902,712	T3A	probably benign	Het

Other mutations in Cntnap4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00847:Cntnap4	APN	8	112767619	splice site	probably benign
IGL01898:Cntnap4	APN	8	112856307	missense	possibly damaging	0.46
IGL01918:Cntnap4	APN	8	112752234	missense	possibly damaging	0.67
IGL02257:Cntnap4	APN	8	112616494	missense	probably damaging	1.00
IGL02302:Cntnap4	APN	8	112785903	splice site	probably benign
IGL02621:Cntnap4	APN	8	112810723	missense	probably damaging	1.00
IGL03008:Cntnap4	APN	8	112773590	missense	probably benign	0.06
IGL03327:Cntnap4	APN	8	112773576	missense	probably benign	0.00
IGL03346:Cntnap4	APN	8	112773576	missense	probably benign	0.00
R0025:Cntnap4	UTSW	8	112803164	missense	probably damaging	1.00
R0025:Cntnap4	UTSW	8	112803164	missense	probably damaging	1.00
R0058:Cntnap4	UTSW	8	112785784	missense	probably damaging	0.98
R0310:Cntnap4	UTSW	8	112842516	critical splice acceptor site	probably null
R0363:Cntnap4	UTSW	8	112856511	nonsense	probably null
R0497:Cntnap4	UTSW	8	112570151	missense	probably benign	0.00
R1495:Cntnap4	UTSW	8	112881763	missense	possibly damaging	0.81
R1579:Cntnap4	UTSW	8	112881830	missense	possibly damaging	0.89
R1704:Cntnap4	UTSW	8	112757523	missense	probably damaging	1.00
R1943:Cntnap4	UTSW	8	112815496	missense	probably benign	0.10
R2160:Cntnap4	UTSW	8	112757571	missense	probably damaging	1.00
R2226:Cntnap4	UTSW	8	112815488	missense	probably damaging	0.98
R3148:Cntnap4	UTSW	8	112757439	missense	probably damaging	1.00
R3916:Cntnap4	UTSW	8	112875533	missense	probably benign	0.02
R3917:Cntnap4	UTSW	8	112875533	missense	probably benign	0.02
R4097:Cntnap4	UTSW	8	112752307	missense	probably benign	0.03
R4348:Cntnap4	UTSW	8	112753922	missense	probably damaging	1.00
R4469:Cntnap4	UTSW	8	112665266	missense	probably damaging	1.00
R4530:Cntnap4	UTSW	8	112858210	missense	probably benign	0.32
R4531:Cntnap4	UTSW	8	112810608	missense	possibly damaging	0.90
R4586:Cntnap4	UTSW	8	112810710	missense	probably benign
R4611:Cntnap4	UTSW	8	112773739	critical splice donor site	probably null
R4675:Cntnap4	UTSW	8	112785836	missense	probably damaging	1.00
R4801:Cntnap4	UTSW	8	112773590	missense	possibly damaging	0.94
R4802:Cntnap4	UTSW	8	112773590	missense	possibly damaging	0.94
R5273:Cntnap4	UTSW	8	112733438	missense	probably damaging	1.00
R6114:Cntnap4	UTSW	8	112841753	missense	probably damaging	1.00
R6194:Cntnap4	UTSW	8	112875429	missense	probably damaging	1.00
R6222:Cntnap4	UTSW	8	112842721	missense	probably damaging	1.00
R6262:Cntnap4	UTSW	8	112803211	missense	probably damaging	0.99
R6276:Cntnap4	UTSW	8	112752289	missense	possibly damaging	0.94
R6483:Cntnap4	UTSW	8	112757473	missense	possibly damaging	0.82
R6819:Cntnap4	UTSW	8	112803226	missense	probably benign	0.03
R7031:Cntnap4	UTSW	8	112858242	missense	probably benign	0.01
R7146:Cntnap4	UTSW	8	112810636	missense	probably damaging	1.00
R7192:Cntnap4	UTSW	8	112881800	missense	probably benign	0.05
R7232:Cntnap4	UTSW	8	112665099	splice site	probably null
R7348:Cntnap4	UTSW	8	112665277	missense	probably damaging	1.00
R7482:Cntnap4	UTSW	8	112733562	critical splice donor site	probably null
R7832:Cntnap4	UTSW	8	112757481	missense	probably benign
R7895:Cntnap4	UTSW	8	112752197	missense	probably damaging	0.99
R8014:Cntnap4	UTSW	8	112753945	missense	probably damaging	0.99
R8185:Cntnap4	UTSW	8	112665265	missense	probably damaging	1.00
R8197:Cntnap4	UTSW	8	112570225	missense	probably benign	0.00
R8287:Cntnap4	UTSW	8	112859143	missense	probably damaging	1.00
R8299:Cntnap4	UTSW	8	112773692	missense	probably damaging	1.00
R8498:Cntnap4	UTSW	8	112875579	missense	possibly damaging	0.52
X0025:Cntnap4	UTSW	8	112859143	missense	probably damaging	1.00
X0063:Cntnap4	UTSW	8	112875579	missense	probably benign	0.05
Z1088:Cntnap4	UTSW	8	112815520	missense	probably damaging	1.00
Z1176:Cntnap4	UTSW	8	112858189	missense	possibly damaging	0.70

Predicted Primers

PCR Primer
(F):5'- ACATCTTGCCATATTTTCTGCGATG -3'
(R):5'- TGGGTTTTCCTGATACACTTCAG -3'

Sequencing Primer
(F):5'- GTGCTGGGAAAATCGTTG -3'
(R):5'- GGTTTTCCTGATACACTTCAGATCAC -3'

Posted On

2019-05-15