Mutagenetix > Incidental Mutation

Incidental Mutation 'R7107:Myo9a'

551253

Institutional Source

Beutler Lab

Gene Symbol

Myo9a

Ensembl Gene

ENSMUSG00000039585

Gene Name

myosin IXa

Synonyms

C130068I12Rik, 4732465J09Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7107 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

59750896-59928866 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 59870815 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 1285 (I1285V)

Ref Sequence

ENSEMBL: ENSMUSP00000122852 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000128341] [ENSMUST00000135298] [ENSMUST00000136740]

AlphaFold

Q8C170

Predicted Effect

probably benign
Transcript: ENSMUST00000128341
AA Change: I1285V

PolyPhen 2 Score 0.256 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000119401
Gene: ENSMUSG00000039585
AA Change: I1285V

Domain	Start	End	E-Value	Type
RA	14	112	5.57e-30	SMART
low complexity region	129	137	N/A	INTRINSIC
MYSc	140	1018	N/A	SMART
IQ	1019	1041	1.79e1	SMART
IQ	1042	1064	4.11e0	SMART
IQ	1074	1096	1.9e-2	SMART
IQ	1115	1137	1.01e-6	SMART
IQ	1138	1160	8.71e-2	SMART
low complexity region	1161	1173	N/A	INTRINSIC
coiled coil region	1265	1285	N/A	INTRINSIC
low complexity region	1372	1384	N/A	INTRINSIC
coiled coil region	1492	1539	N/A	INTRINSIC
Blast:MYSc	1685	1938	6e-89	BLAST
low complexity region	1982	1993	N/A	INTRINSIC
C1	2002	2050	2.6e-9	SMART
RhoGAP	2075	2250	3.36e-73	SMART
coiled coil region	2320	2360	N/A	INTRINSIC
low complexity region	2419	2438	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000135298
AA Change: I1285V

PolyPhen 2 Score 0.576 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000117432
Gene: ENSMUSG00000039585
AA Change: I1285V

Domain	Start	End	E-Value	Type
RA	14	112	5.57e-30	SMART
low complexity region	129	137	N/A	INTRINSIC
MYSc	140	1018	N/A	SMART
IQ	1019	1041	1.79e1	SMART
IQ	1042	1064	4.11e0	SMART
IQ	1074	1096	1.9e-2	SMART
IQ	1115	1137	1.01e-6	SMART
IQ	1138	1160	8.71e-2	SMART
low complexity region	1161	1173	N/A	INTRINSIC
coiled coil region	1265	1285	N/A	INTRINSIC
low complexity region	1372	1384	N/A	INTRINSIC
coiled coil region	1492	1539	N/A	INTRINSIC
low complexity region	1744	1759	N/A	INTRINSIC
low complexity region	2053	2064	N/A	INTRINSIC
C1	2073	2121	2.6e-9	SMART
RhoGAP	2146	2321	3.36e-73	SMART
coiled coil region	2391	2431	N/A	INTRINSIC
low complexity region	2490	2509	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000136740
AA Change: I1285V

PolyPhen 2 Score 0.441 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000122852
Gene: ENSMUSG00000039585
AA Change: I1285V

Domain	Start	End	E-Value	Type
RA	14	112	5.57e-30	SMART
low complexity region	129	137	N/A	INTRINSIC
MYSc	140	1018	N/A	SMART
IQ	1019	1041	1.79e1	SMART
IQ	1042	1064	4.11e0	SMART
IQ	1074	1096	1.9e-2	SMART
IQ	1115	1137	1.01e-6	SMART
IQ	1138	1160	8.71e-2	SMART
low complexity region	1161	1173	N/A	INTRINSIC
coiled coil region	1265	1285	N/A	INTRINSIC
low complexity region	1372	1384	N/A	INTRINSIC
coiled coil region	1492	1539	N/A	INTRINSIC
low complexity region	1744	1759	N/A	INTRINSIC
low complexity region	2053	2064	N/A	INTRINSIC
C1	2073	2121	2.6e-9	SMART
RhoGAP	2146	2321	3.36e-73	SMART
coiled coil region	2409	2449	N/A	INTRINSIC
low complexity region	2508	2527	N/A	INTRINSIC

Meta Mutation Damage Score

0.0735

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

99% (78/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin superfamily. The protein represents an unconventional myosin; it should not be confused with the conventional non-muscle myosin-9 (MYH9). Unconventional myosins contain the basic domains of conventional myosins and are further distinguished from class members by their tail domains. They function as actin-based molecular motors. Mutations in this gene have been associated with Bardet-Biedl Syndrome. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous KO leads to obstructive hydrocephaly caused by blockage of the third ventricle and the rostral aqueduct caused by developmental failures of their ependymal cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	T	A	13: 59,742,183	R608*	probably null	Het
4922502D21Rik	A	G	6: 129,322,952	C188R	probably damaging	Het
Abca8b	A	G	11: 109,976,473	L253S	probably damaging	Het
Adgrv1	T	C	13: 81,578,142	E588G	probably benign	Het
Ahcy	G	A	2: 155,068,973	A25V	probably damaging	Het
Ank2	A	C	3: 127,003,982	L710R	probably damaging	Het
Ap1b1	A	G	11: 5,039,558	T824A	probably benign	Het
Arap2	T	A	5: 62,606,208	H1531L	probably damaging	Het
B3gnt7	T	C	1: 86,305,773	L247P	probably damaging	Het
Bcl6b	A	G	11: 70,226,570	C409R	probably damaging	Het
Bicdl1	T	C	5: 115,670,170	H301R	probably benign	Het
Casc3	T	A	11: 98,827,587	I491N	possibly damaging	Het
Ccdc92b	T	A	11: 74,630,061	L63Q	probably damaging	Het
Cep250	A	G	2: 155,995,394	T2319A	probably benign	Het
Chd1	T	C	17: 15,761,366	S1356P	probably damaging	Het
Chd8	A	G	14: 52,212,672	S1542P	probably benign	Het
Cntnap4	A	G	8: 112,815,488	D751G	probably damaging	Het
Cpsf4l	G	A	11: 113,702,489	R90C	possibly damaging	Het
Defa21	G	A	8: 21,025,708	A41T	probably damaging	Het
Dennd4a	G	T	9: 64,894,399	L941F	possibly damaging	Het
Dnah12	G	A	14: 26,778,912		probably null	Het
Dtx4	A	T	19: 12,473,260	C529*	probably null	Het
Entpd3	A	G	9: 120,560,599	Y317C	probably damaging	Het
Erp29	T	A	5: 121,445,318	I182F	possibly damaging	Het
Fam161a	A	G	11: 23,023,452	R445G	possibly damaging	Het
Fam214b	A	T	4: 43,036,434	V99E	probably benign	Het
Fam76a	T	A	4: 132,903,921	M238L	possibly damaging	Het
Fn1	T	C	1: 71,627,249	Y875C	probably damaging	Het
Gnb2	A	G	5: 137,530,182		probably null	Het
Hspg2	T	C	4: 137,510,652	S229P	probably damaging	Het
Ighv6-6	A	G	12: 114,434,970	S59P	probably damaging	Het
Itpkc	C	A	7: 27,228,277	A71S	probably benign	Het
Kcnk10	G	A	12: 98,518,743	R45*	probably null	Het
Krcc1	A	G	6: 71,284,214	S77G	probably benign	Het
Lelp1	G	A	3: 92,135,514	T76I	unknown	Het
Lifr	A	T	15: 7,178,940	I600F	possibly damaging	Het
Lrrk1	T	A	7: 66,287,443	D987V	possibly damaging	Het
Mfsd7a	T	A	5: 108,448,715		probably null	Het
Muc16	C	T	9: 18,637,298	D5900N	probably benign	Het
Muc6	AGGCGCAGAAACCCTGGC	AGGC	7: 141,634,450		probably null	Het
Ndel1	T	C	11: 68,822,648	D321G	possibly damaging	Het
Nlrp4b	T	C	7: 10,715,217	V449A	probably damaging	Het
Olfr1386	T	A	11: 49,470,434	Y94*	probably null	Het
Olfr1495	A	G	19: 13,769,161	E273G	probably benign	Het
Olfr195	A	C	16: 59,148,916	D22A	probably benign	Het
Olfr458	T	C	6: 42,460,554	N155S	possibly damaging	Het
Olfr639	A	T	7: 104,012,282	L140Q	probably benign	Het
Osbpl1a	G	A	18: 12,841,253	R459*	probably null	Het
Pabpc1l	A	C	2: 164,042,479	T379P	probably damaging	Het
Pde2a	A	T	7: 101,421,968	Q15L	probably benign	Het
Pdk1	A	G	2: 71,895,741	N331S	probably benign	Het
Pfdn1	A	T	18: 36,451,466		probably null	Het
Pnliprp1	T	A	19: 58,729,150	L9H	probably damaging	Het
Prl7a2	A	T	13: 27,659,093	D242E	possibly damaging	Het
Prmt9	T	A	8: 77,568,251	I408N	possibly damaging	Het
Psme4	G	A	11: 30,848,105	R1366H	probably benign	Het
Pstpip1	A	T	9: 56,128,650	D393V	probably damaging	Het
Rab5b	A	G	10: 128,683,193		probably null	Het
Rap1gap2	G	A	11: 74,393,119	R618C	probably damaging	Het
Rin1	A	G	19: 5,050,773		probably benign	Het
Sall3	G	A	18: 80,973,754	P320S	probably benign	Het
Sdk1	A	G	5: 142,081,716	T1124A	probably damaging	Het
Sirpb1c	T	A	3: 15,838,777	T88S	possibly damaging	Het
Slc35f6	T	A	5: 30,656,777	I189N	probably damaging	Het
Spsb2	A	T	6: 124,810,281	Q226L	probably benign	Het
Stab2	T	C	10: 86,905,592	D1221G	possibly damaging	Het
Sugp1	G	A	8: 70,070,150	R500H	probably benign	Het
Syne1	A	G	10: 5,132,078	Y849H	probably damaging	Het
Tbck	T	A	3: 132,722,331	I249N	possibly damaging	Het
Tdrd6	A	C	17: 43,624,204	F1984L	probably benign	Het
Tnxb	T	A	17: 34,671,340	V219E	unknown	Het
Tpst1	T	A	5: 130,114,503	V294D	probably damaging	Het
Treml1	A	G	17: 48,360,219	Q44R	probably damaging	Het
Trrap	G	A	5: 144,797,135	A933T	probably benign	Het
Vars2	A	G	17: 35,658,250	L853P	probably damaging	Het
Vmn1r10	A	T	6: 57,113,630	N69I	possibly damaging	Het
Vmn1r179	T	A	7: 23,928,394	Y3*	probably null	Het
Vmn2r38	T	A	7: 9,090,729	Y498F	probably benign	Het
Zc3h11a	T	C	1: 133,638,917	T179A	probably damaging	Het
Zmym2	A	G	14: 56,902,712	T3A	probably benign	Het

Other mutations in Myo9a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Myo9a	APN	9	59843059	splice site	probably benign
IGL00510:Myo9a	APN	9	59832181	splice site	probably benign
IGL00710:Myo9a	APN	9	59875311	missense	probably damaging	1.00
IGL00963:Myo9a	APN	9	59900372	missense	probably damaging	0.98
IGL01087:Myo9a	APN	9	59790078	missense	possibly damaging	0.93
IGL01145:Myo9a	APN	9	59855375	missense	probably benign	0.18
IGL01403:Myo9a	APN	9	59871563	missense	probably damaging	0.98
IGL01528:Myo9a	APN	9	59779674	missense	probably damaging	1.00
IGL01608:Myo9a	APN	9	59870836	nonsense	probably null
IGL01701:Myo9a	APN	9	59884594	critical splice donor site	probably null
IGL01918:Myo9a	APN	9	59779702	missense	probably damaging	1.00
IGL02026:Myo9a	APN	9	59905962	missense	probably damaging	0.99
IGL02139:Myo9a	APN	9	59779992	missense	probably benign	0.07
IGL02176:Myo9a	APN	9	59870553	missense	probably benign	0.45
IGL02272:Myo9a	APN	9	59884600	splice site	probably benign
IGL02283:Myo9a	APN	9	59871673	missense	probably benign	0.00
IGL02499:Myo9a	APN	9	59815386	splice site	probably benign
IGL02652:Myo9a	APN	9	59863928	missense	probably damaging	1.00
IGL02666:Myo9a	APN	9	59924904	missense	probably benign	0.02
IGL02878:Myo9a	APN	9	59908300	critical splice donor site	probably null
IGL02982:Myo9a	APN	9	59908208	nonsense	probably null
IGL03072:Myo9a	APN	9	59809442	missense	possibly damaging	0.83
IGL03090:Myo9a	APN	9	59894135	splice site	probably benign
IGL03111:Myo9a	APN	9	59827243	missense	probably benign	0.19
IGL03389:Myo9a	APN	9	59869607	missense	probably damaging	1.00
essentials	UTSW	9	59894866	missense	probably benign	0.09
necessities	UTSW	9	59815334	missense	probably damaging	1.00
PIT4402001:Myo9a	UTSW	9	59870436	missense	possibly damaging	0.83
R0013:Myo9a	UTSW	9	59860206	splice site	probably benign
R0013:Myo9a	UTSW	9	59860206	splice site	probably benign
R0018:Myo9a	UTSW	9	59871724	missense	probably benign	0.00
R0018:Myo9a	UTSW	9	59871724	missense	probably benign	0.00
R0329:Myo9a	UTSW	9	59923677	missense	probably damaging	1.00
R0423:Myo9a	UTSW	9	59895336	missense	probably damaging	1.00
R0521:Myo9a	UTSW	9	59894352	missense	probably damaging	1.00
R0607:Myo9a	UTSW	9	59921793	missense	probably benign	0.02
R0652:Myo9a	UTSW	9	59871926	missense	probably benign
R0653:Myo9a	UTSW	9	59924991	missense	probably damaging	1.00
R0723:Myo9a	UTSW	9	59871100	missense	probably benign	0.01
R0784:Myo9a	UTSW	9	59896545	splice site	probably benign
R0842:Myo9a	UTSW	9	59871067	missense	probably benign	0.02
R1055:Myo9a	UTSW	9	59855370	missense	probably benign	0.01
R1056:Myo9a	UTSW	9	59832201	missense	possibly damaging	0.64
R1195:Myo9a	UTSW	9	59895200	missense	probably damaging	1.00
R1195:Myo9a	UTSW	9	59895200	missense	probably damaging	1.00
R1195:Myo9a	UTSW	9	59895200	missense	probably damaging	1.00
R1615:Myo9a	UTSW	9	59788456	missense	possibly damaging	0.68
R1698:Myo9a	UTSW	9	59868181	missense	probably benign	0.05
R1715:Myo9a	UTSW	9	59832300	missense	probably damaging	0.99
R1981:Myo9a	UTSW	9	59894146	missense	probably benign
R2228:Myo9a	UTSW	9	59894180	missense	probably benign	0.06
R2272:Myo9a	UTSW	9	59815301	missense	probably damaging	1.00
R2327:Myo9a	UTSW	9	59779765	missense	probably benign	0.11
R2990:Myo9a	UTSW	9	59924889	missense	possibly damaging	0.95
R3161:Myo9a	UTSW	9	59832315	splice site	probably benign
R3721:Myo9a	UTSW	9	59868180	missense	probably benign
R3928:Myo9a	UTSW	9	59895283	missense	probably damaging	1.00
R4197:Myo9a	UTSW	9	59894866	missense	probably benign	0.09
R4212:Myo9a	UTSW	9	59906066	nonsense	probably null
R4610:Myo9a	UTSW	9	59871882	missense	probably benign
R4616:Myo9a	UTSW	9	59821649	missense	probably damaging	1.00
R4621:Myo9a	UTSW	9	59871072	missense	probably benign	0.00
R4623:Myo9a	UTSW	9	59871072	missense	probably benign	0.00
R4632:Myo9a	UTSW	9	59869664	missense	probably benign	0.00
R4657:Myo9a	UTSW	9	59875416	critical splice donor site	probably null
R4892:Myo9a	UTSW	9	59824242	missense	probably damaging	0.98
R4897:Myo9a	UTSW	9	59896517	missense	probably benign	0.07
R4966:Myo9a	UTSW	9	59871734	missense	probably benign	0.00
R4993:Myo9a	UTSW	9	59861472	nonsense	probably null
R5160:Myo9a	UTSW	9	59871802	missense	probably benign	0.24
R5233:Myo9a	UTSW	9	59910617	missense	probably damaging	1.00
R5271:Myo9a	UTSW	9	59907382	missense	probably damaging	1.00
R5308:Myo9a	UTSW	9	59863961	missense	probably damaging	1.00
R5367:Myo9a	UTSW	9	59900449	missense	probably damaging	0.96
R5432:Myo9a	UTSW	9	59865670	missense	possibly damaging	0.94
R5459:Myo9a	UTSW	9	59884520	missense	probably damaging	0.98
R5511:Myo9a	UTSW	9	59780212	missense	probably damaging	1.00
R5568:Myo9a	UTSW	9	59874628	missense	probably benign
R5573:Myo9a	UTSW	9	59871001	missense	probably benign
R5589:Myo9a	UTSW	9	59895244	nonsense	probably null
R5607:Myo9a	UTSW	9	59863944	missense	probably damaging	1.00
R5633:Myo9a	UTSW	9	59868184	missense	possibly damaging	0.60
R5885:Myo9a	UTSW	9	59871220	missense	probably benign
R6024:Myo9a	UTSW	9	59855388	missense	possibly damaging	0.68
R6086:Myo9a	UTSW	9	59790057	nonsense	probably null
R6146:Myo9a	UTSW	9	59871229	missense	probably benign	0.01
R6194:Myo9a	UTSW	9	59869750	missense	probably benign	0.00
R6213:Myo9a	UTSW	9	59827258	missense	probably damaging	1.00
R6368:Myo9a	UTSW	9	59924948	missense	probably benign	0.01
R6550:Myo9a	UTSW	9	59868199	missense	probably damaging	1.00
R6612:Myo9a	UTSW	9	59827196	missense	probably damaging	1.00
R6665:Myo9a	UTSW	9	59871872	missense	probably benign	0.09
R6951:Myo9a	UTSW	9	59894768	missense	probably damaging	1.00
R7026:Myo9a	UTSW	9	59815334	missense	probably damaging	1.00
R7310:Myo9a	UTSW	9	59871153	missense	probably benign	0.08
R7473:Myo9a	UTSW	9	59895244	missense	probably benign	0.31
R7723:Myo9a	UTSW	9	59779858	missense	probably damaging	1.00
R7823:Myo9a	UTSW	9	59811950	missense	probably damaging	1.00
R7824:Myo9a	UTSW	9	59860109	missense	probably damaging	1.00
R7965:Myo9a	UTSW	9	59788438	missense	probably damaging	1.00
R8031:Myo9a	UTSW	9	59780091	missense	probably benign	0.33
R8055:Myo9a	UTSW	9	59907460	missense	probably damaging	1.00
R8071:Myo9a	UTSW	9	59874648	missense	probably benign
R8250:Myo9a	UTSW	9	59860109	missense	probably damaging	1.00
R8260:Myo9a	UTSW	9	59910678	missense	probably benign	0.08
R8355:Myo9a	UTSW	9	59909847	missense	probably damaging	1.00
R8432:Myo9a	UTSW	9	59780265	missense	probably damaging	1.00
R8470:Myo9a	UTSW	9	59832290	missense	probably damaging	1.00
R8528:Myo9a	UTSW	9	59860140	missense	probably damaging	1.00
R8681:Myo9a	UTSW	9	59868111	missense	probably benign	0.16
R8690:Myo9a	UTSW	9	59875374	missense	probably benign
R8793:Myo9a	UTSW	9	59884567	missense	probably benign	0.03
R8812:Myo9a	UTSW	9	59779747	missense	probably benign	0.14
R9016:Myo9a	UTSW	9	59868144	nonsense	probably null
R9026:Myo9a	UTSW	9	59809474	missense	probably damaging	0.96
R9036:Myo9a	UTSW	9	59780301	nonsense	probably null
R9130:Myo9a	UTSW	9	59832231	missense	probably damaging	0.98
R9131:Myo9a	UTSW	9	59861489	missense	probably damaging	1.00
R9213:Myo9a	UTSW	9	59865639	missense	probably benign	0.04
R9498:Myo9a	UTSW	9	59827183	missense	probably damaging	1.00
R9575:Myo9a	UTSW	9	59905907	missense	not run
RF018:Myo9a	UTSW	9	59869586	missense	probably benign	0.00
RF019:Myo9a	UTSW	9	59921772	missense	probably benign	0.00
Z1176:Myo9a	UTSW	9	59895259	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCGAATTAGCCGTGAGAGTTC -3'
(R):5'- CTAAAATGAGAGACTCTGGTTTGCTC -3'

Sequencing Primer
(F):5'- TCAATGGACTTCTCAAAGGAGTCTCC -3'
(R):5'- GCTCTTTTGGTTCTCATCACAGG -3'

Posted On

2019-05-15