Incidental Mutation 'R7107:Dennd4a'
ID551254
Institutional Source Beutler Lab
Gene Symbol Dennd4a
Ensembl Gene ENSMUSG00000053641
Gene NameDENN/MADD domain containing 4A
SynonymsF730015K02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.428) question?
Stock #R7107 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location64811340-64919667 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 64894399 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 941 (L941F)
Ref Sequence ENSEMBL: ENSMUSP00000037915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038890]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038890
AA Change: L941F

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000037915
Gene: ENSMUSG00000053641
AA Change: L941F

DomainStartEndE-ValueType
internal_repeat_1 45 93 3.26e-5 PROSPERO
uDENN 169 276 1.71e-28 SMART
DENN 309 493 2.4e-73 SMART
dDENN 559 633 4.15e-27 SMART
low complexity region 724 735 N/A INTRINSIC
low complexity region 936 950 N/A INTRINSIC
low complexity region 1176 1191 N/A INTRINSIC
low complexity region 1249 1262 N/A INTRINSIC
low complexity region 1402 1417 N/A INTRINSIC
Meta Mutation Damage Score 0.212 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DENN domain-containing protein that may function as a guanine nucleotide exchange factor that specifically activates ras-related protein Rab-10. This protein also contains a interferon stimulated response element-binding domain and may be involved in regulating the v-myc avian myelocytomatosis viral (MYC) oncogene. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 8. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T A 13: 59,742,183 R608* probably null Het
4922502D21Rik A G 6: 129,322,952 C188R probably damaging Het
Abca8b A G 11: 109,976,473 L253S probably damaging Het
Adgrv1 T C 13: 81,578,142 E588G probably benign Het
Ahcy G A 2: 155,068,973 A25V probably damaging Het
Ank2 A C 3: 127,003,982 L710R probably damaging Het
Ap1b1 A G 11: 5,039,558 T824A probably benign Het
Arap2 T A 5: 62,606,208 H1531L probably damaging Het
B3gnt7 T C 1: 86,305,773 L247P probably damaging Het
Bcl6b A G 11: 70,226,570 C409R probably damaging Het
Bicdl1 T C 5: 115,670,170 H301R probably benign Het
Casc3 T A 11: 98,827,587 I491N possibly damaging Het
Ccdc92b T A 11: 74,630,061 L63Q probably damaging Het
Cep250 A G 2: 155,995,394 T2319A probably benign Het
Chd1 T C 17: 15,761,366 S1356P probably damaging Het
Chd8 A G 14: 52,212,672 S1542P probably benign Het
Cntnap4 A G 8: 112,815,488 D751G probably damaging Het
Cpsf4l G A 11: 113,702,489 R90C possibly damaging Het
Defa21 G A 8: 21,025,708 A41T probably damaging Het
Dnah12 G A 14: 26,778,912 probably null Het
Dtx4 A T 19: 12,473,260 C529* probably null Het
Entpd3 A G 9: 120,560,599 Y317C probably damaging Het
Erp29 T A 5: 121,445,318 I182F possibly damaging Het
Fam161a A G 11: 23,023,452 R445G possibly damaging Het
Fam214b A T 4: 43,036,434 V99E probably benign Het
Fam76a T A 4: 132,903,921 M238L possibly damaging Het
Fn1 T C 1: 71,627,249 Y875C probably damaging Het
Gnb2 A G 5: 137,530,182 probably null Het
Hspg2 T C 4: 137,510,652 S229P probably damaging Het
Ighv6-6 A G 12: 114,434,970 S59P probably damaging Het
Itpkc C A 7: 27,228,277 A71S probably benign Het
Kcnk10 G A 12: 98,518,743 R45* probably null Het
Krcc1 A G 6: 71,284,214 S77G probably benign Het
Lelp1 G A 3: 92,135,514 T76I unknown Het
Lifr A T 15: 7,178,940 I600F possibly damaging Het
Lrrk1 T A 7: 66,287,443 D987V possibly damaging Het
Mfsd7a T A 5: 108,448,715 probably null Het
Muc16 C T 9: 18,637,298 D5900N probably benign Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,634,450 probably null Het
Myo9a A G 9: 59,870,815 I1285V probably benign Het
Ndel1 T C 11: 68,822,648 D321G possibly damaging Het
Nlrp4b T C 7: 10,715,217 V449A probably damaging Het
Olfr1386 T A 11: 49,470,434 Y94* probably null Het
Olfr1495 A G 19: 13,769,161 E273G probably benign Het
Olfr195 A C 16: 59,148,916 D22A probably benign Het
Olfr458 T C 6: 42,460,554 N155S possibly damaging Het
Olfr639 A T 7: 104,012,282 L140Q probably benign Het
Osbpl1a G A 18: 12,841,253 R459* probably null Het
Pabpc1l A C 2: 164,042,479 T379P probably damaging Het
Pde2a A T 7: 101,421,968 Q15L probably benign Het
Pdk1 A G 2: 71,895,741 N331S probably benign Het
Pfdn1 A T 18: 36,451,466 probably null Het
Pnliprp1 T A 19: 58,729,150 L9H probably damaging Het
Prl7a2 A T 13: 27,659,093 D242E possibly damaging Het
Prmt9 T A 8: 77,568,251 I408N possibly damaging Het
Psme4 G A 11: 30,848,105 R1366H probably benign Het
Pstpip1 A T 9: 56,128,650 D393V probably damaging Het
Rab5b A G 10: 128,683,193 probably null Het
Rap1gap2 G A 11: 74,393,119 R618C probably damaging Het
Rin1 A G 19: 5,050,773 probably benign Het
Sall3 G A 18: 80,973,754 P320S probably benign Het
Sdk1 A G 5: 142,081,716 T1124A probably damaging Het
Sirpb1c T A 3: 15,838,777 T88S possibly damaging Het
Slc35f6 T A 5: 30,656,777 I189N probably damaging Het
Spsb2 A T 6: 124,810,281 Q226L probably benign Het
Stab2 T C 10: 86,905,592 D1221G possibly damaging Het
Sugp1 G A 8: 70,070,150 R500H probably benign Het
Syne1 A G 10: 5,132,078 Y849H probably damaging Het
Tbck T A 3: 132,722,331 I249N possibly damaging Het
Tdrd6 A C 17: 43,624,204 F1984L probably benign Het
Tnxb T A 17: 34,671,340 V219E unknown Het
Tpst1 T A 5: 130,114,503 V294D probably damaging Het
Treml1 A G 17: 48,360,219 Q44R probably damaging Het
Trrap G A 5: 144,797,135 A933T probably benign Het
Vars2 A G 17: 35,658,250 L853P probably damaging Het
Vmn1r10 A T 6: 57,113,630 N69I possibly damaging Het
Vmn1r179 T A 7: 23,928,394 Y3* probably null Het
Vmn2r38 T A 7: 9,090,729 Y498F probably benign Het
Zc3h11a T C 1: 133,638,917 T179A probably damaging Het
Zmym2 A G 14: 56,902,712 T3A probably benign Het
Other mutations in Dennd4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Dennd4a APN 9 64911762 missense probably damaging 1.00
IGL01610:Dennd4a APN 9 64906884 missense probably damaging 0.99
IGL01788:Dennd4a APN 9 64842621 missense probably benign 0.00
IGL01827:Dennd4a APN 9 64842561 nonsense probably null
IGL01828:Dennd4a APN 9 64842561 nonsense probably null
IGL01829:Dennd4a APN 9 64842561 nonsense probably null
IGL01979:Dennd4a APN 9 64894409 missense probably benign 0.00
IGL02100:Dennd4a APN 9 64909706 splice site probably benign
IGL02339:Dennd4a APN 9 64842561 nonsense probably null
IGL02341:Dennd4a APN 9 64842561 nonsense probably null
IGL02584:Dennd4a APN 9 64851298 missense probably damaging 1.00
IGL02607:Dennd4a APN 9 64862327 missense probably damaging 0.99
IGL02654:Dennd4a APN 9 64910191 splice site probably benign
IGL02701:Dennd4a APN 9 64897353 missense possibly damaging 0.50
IGL03051:Dennd4a APN 9 64862414 missense probably damaging 1.00
IGL03257:Dennd4a APN 9 64871874 missense possibly damaging 0.93
IGL03346:Dennd4a APN 9 64888526 missense possibly damaging 0.47
IGL03349:Dennd4a APN 9 64888974 missense probably damaging 1.00
IGL03398:Dennd4a APN 9 64871882 missense probably benign 0.32
R0010:Dennd4a UTSW 9 64896715 missense probably benign 0.00
R0010:Dennd4a UTSW 9 64896715 missense probably benign 0.00
R0129:Dennd4a UTSW 9 64893294 missense probably damaging 1.00
R0220:Dennd4a UTSW 9 64852445 missense probably damaging 1.00
R0396:Dennd4a UTSW 9 64862391 missense probably damaging 1.00
R0881:Dennd4a UTSW 9 64851383 critical splice donor site probably null
R1225:Dennd4a UTSW 9 64911675 missense probably benign 0.03
R1311:Dennd4a UTSW 9 64910004 missense probably benign 0.34
R1448:Dennd4a UTSW 9 64906045 missense possibly damaging 0.95
R1450:Dennd4a UTSW 9 64911665 missense probably benign 0.03
R1630:Dennd4a UTSW 9 64871882 missense probably benign 0.32
R1709:Dennd4a UTSW 9 64889605 missense possibly damaging 0.92
R1824:Dennd4a UTSW 9 64859358 critical splice donor site probably null
R1851:Dennd4a UTSW 9 64862030 missense probably damaging 1.00
R1870:Dennd4a UTSW 9 64897234 missense probably benign 0.00
R1900:Dennd4a UTSW 9 64897336 missense probably damaging 0.99
R1911:Dennd4a UTSW 9 64889086 missense probably damaging 1.00
R1938:Dennd4a UTSW 9 64842490 missense probably damaging 1.00
R1954:Dennd4a UTSW 9 64852467 missense probably benign 0.02
R1955:Dennd4a UTSW 9 64852467 missense probably benign 0.02
R2049:Dennd4a UTSW 9 64889605 missense possibly damaging 0.92
R2129:Dennd4a UTSW 9 64905974 intron probably null
R2138:Dennd4a UTSW 9 64889337 missense probably damaging 1.00
R2929:Dennd4a UTSW 9 64852417 missense possibly damaging 0.85
R3083:Dennd4a UTSW 9 64906081 missense probably benign 0.03
R3108:Dennd4a UTSW 9 64912387 missense probably benign 0.23
R3176:Dennd4a UTSW 9 64888993 missense probably damaging 1.00
R3177:Dennd4a UTSW 9 64888993 missense probably damaging 1.00
R3276:Dennd4a UTSW 9 64888993 missense probably damaging 1.00
R3277:Dennd4a UTSW 9 64888993 missense probably damaging 1.00
R3890:Dennd4a UTSW 9 64872028 missense probably damaging 1.00
R3953:Dennd4a UTSW 9 64852575 missense probably damaging 1.00
R3963:Dennd4a UTSW 9 64862331 missense probably damaging 1.00
R4059:Dennd4a UTSW 9 64911892 missense possibly damaging 0.92
R4499:Dennd4a UTSW 9 64910123 missense possibly damaging 0.78
R4500:Dennd4a UTSW 9 64910123 missense possibly damaging 0.78
R4501:Dennd4a UTSW 9 64910123 missense possibly damaging 0.78
R4671:Dennd4a UTSW 9 64894407 missense probably benign
R4701:Dennd4a UTSW 9 64897357 missense possibly damaging 0.91
R4821:Dennd4a UTSW 9 64897249 missense possibly damaging 0.92
R4829:Dennd4a UTSW 9 64889056 missense probably damaging 1.00
R4876:Dennd4a UTSW 9 64896590 missense probably benign
R4881:Dennd4a UTSW 9 64838844 missense possibly damaging 0.77
R4962:Dennd4a UTSW 9 64906003 missense probably benign 0.00
R5225:Dennd4a UTSW 9 64888928 missense possibly damaging 0.94
R5557:Dennd4a UTSW 9 64904227 missense probably benign 0.07
R5649:Dennd4a UTSW 9 64851209 splice site probably null
R5868:Dennd4a UTSW 9 64896729 missense probably benign 0.02
R5876:Dennd4a UTSW 9 64911755 missense probably damaging 1.00
R6052:Dennd4a UTSW 9 64886945 missense probably damaging 1.00
R6411:Dennd4a UTSW 9 64871899 missense probably benign 0.04
R6596:Dennd4a UTSW 9 64852420 missense probably damaging 1.00
R6668:Dennd4a UTSW 9 64886965 missense probably damaging 1.00
R6915:Dennd4a UTSW 9 64852489 nonsense probably null
R7056:Dennd4a UTSW 9 64906923 missense possibly damaging 0.89
R7203:Dennd4a UTSW 9 64896474 missense probably benign 0.05
R7238:Dennd4a UTSW 9 64861956 missense probably damaging 1.00
R7373:Dennd4a UTSW 9 64897269 missense probably benign 0.01
R7454:Dennd4a UTSW 9 64852570 missense probably damaging 1.00
R7546:Dennd4a UTSW 9 64873044 missense probably damaging 1.00
X0026:Dennd4a UTSW 9 64897320 missense possibly damaging 0.67
Z1088:Dennd4a UTSW 9 64872022 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGCCTTATATATGACCAGCTCTTAG -3'
(R):5'- GACACAGATACACTTCATTCTGC -3'

Sequencing Primer
(F):5'- AATTTGGTCCACACTTGATGGC -3'
(R):5'- CAGATACACTTCATTCTGCATATGC -3'
Posted On2019-05-15