Incidental Mutation 'R7107:Stab2'
ID551257
Institutional Source Beutler Lab
Gene Symbol Stab2
Ensembl Gene ENSMUSG00000035459
Gene Namestabilin 2
SynonymsSTAB-2, FEEL-2
MMRRC Submission
Accession Numbers

Genbank: NM_138673; MGI: 2178743

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7107 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location86841198-87008025 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86905592 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1221 (D1221G)
Ref Sequence ENSEMBL: ENSMUSP00000048309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035288]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035288
AA Change: D1221G

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000048309
Gene: ENSMUSG00000035459
AA Change: D1221G

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF 119 156 1.85e0 SMART
EGF 167 201 2.43e1 SMART
EGF 206 244 1.43e-1 SMART
EGF 248 284 3.82e-2 SMART
EGF 333 370 2.02e-1 SMART
FAS1 414 515 1.06e-8 SMART
FAS1 561 662 3.54e-19 SMART
EGF 746 783 6.76e-3 SMART
EGF 836 873 1.31e0 SMART
EGF 877 917 2.99e-4 SMART
EGF 921 960 3.51e-1 SMART
EGF 964 1002 1.99e0 SMART
FAS1 1038 1138 1.73e-13 SMART
FAS1 1181 1276 1.83e-12 SMART
EGF 1354 1391 6.92e0 SMART
EGF 1401 1435 1.11e1 SMART
EGF 1442 1477 3.01e0 SMART
EGF 1481 1519 1.64e-1 SMART
EGF 1523 1561 1.14e0 SMART
EGF 1565 1603 5.62e0 SMART
FAS1 1638 1734 2.23e-25 SMART
FAS1 1785 1891 6.92e-22 SMART
EGF 1966 2006 1.95e1 SMART
EGF_like 1977 2017 2.46e-1 SMART
EGF 2016 2050 1.14e0 SMART
EGF 2058 2089 1.56e1 SMART
EGF 2093 2130 1.36e1 SMART
EGF 2134 2173 2.13e0 SMART
LINK 2204 2298 2.08e-29 SMART
FAS1 2363 2455 3.19e-12 SMART
transmembrane domain 2467 2489 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large, transmembrane receptor protein which may function in angiogenesis, lymphocyte homing, cell adhesion, or receptor scavenging. The protein contains 7 fasciclin, 15 epidermal growth factor (EGF)-like, and 2 laminin-type EGF-like domains as well as a C-type lectin-like hyaluronan-binding Link module. The protein is primarily expressed on sinusoidal endothelial cells of liver, spleen, and lymph node. The receptor has been shown to bind and endocytose ligands such as hyaluronan, low density lipoprotein, Gram-positive and Gram-negative bacteria, and advanced glycosylation end products. Supporting its possible role as a scavenger receptor, the protein has been shown to cycle between the plasma membrane and lysosomes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for knock-out alleles exhibit no gross abnormaities. Mice homozygous for one null allele display elevated serum hyaluronic acid levels and decreased metastasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T A 13: 59,742,183 R608* probably null Het
4922502D21Rik A G 6: 129,322,952 C188R probably damaging Het
Abca8b A G 11: 109,976,473 L253S probably damaging Het
Adgrv1 T C 13: 81,578,142 E588G probably benign Het
Ahcy G A 2: 155,068,973 A25V probably damaging Het
Ank2 A C 3: 127,003,982 L710R probably damaging Het
Ap1b1 A G 11: 5,039,558 T824A probably benign Het
Arap2 T A 5: 62,606,208 H1531L probably damaging Het
B3gnt7 T C 1: 86,305,773 L247P probably damaging Het
Bcl6b A G 11: 70,226,570 C409R probably damaging Het
Bicdl1 T C 5: 115,670,170 H301R probably benign Het
Casc3 T A 11: 98,827,587 I491N possibly damaging Het
Ccdc92b T A 11: 74,630,061 L63Q probably damaging Het
Cep250 A G 2: 155,995,394 T2319A probably benign Het
Chd1 T C 17: 15,761,366 S1356P probably damaging Het
Chd8 A G 14: 52,212,672 S1542P probably benign Het
Cntnap4 A G 8: 112,815,488 D751G probably damaging Het
Cpsf4l G A 11: 113,702,489 R90C possibly damaging Het
Defa21 G A 8: 21,025,708 A41T probably damaging Het
Dennd4a G T 9: 64,894,399 L941F possibly damaging Het
Dnah12 G A 14: 26,778,912 probably null Het
Dtx4 A T 19: 12,473,260 C529* probably null Het
Entpd3 A G 9: 120,560,599 Y317C probably damaging Het
Erp29 T A 5: 121,445,318 I182F possibly damaging Het
Fam161a A G 11: 23,023,452 R445G possibly damaging Het
Fam214b A T 4: 43,036,434 V99E probably benign Het
Fam76a T A 4: 132,903,921 M238L possibly damaging Het
Fn1 T C 1: 71,627,249 Y875C probably damaging Het
Gnb2 A G 5: 137,530,182 probably null Het
Hspg2 T C 4: 137,510,652 S229P probably damaging Het
Ighv6-6 A G 12: 114,434,970 S59P probably damaging Het
Itpkc C A 7: 27,228,277 A71S probably benign Het
Kcnk10 G A 12: 98,518,743 R45* probably null Het
Krcc1 A G 6: 71,284,214 S77G probably benign Het
Lelp1 G A 3: 92,135,514 T76I unknown Het
Lifr A T 15: 7,178,940 I600F possibly damaging Het
Lrrk1 T A 7: 66,287,443 D987V possibly damaging Het
Mfsd7a T A 5: 108,448,715 probably null Het
Muc16 C T 9: 18,637,298 D5900N probably benign Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,634,450 probably null Het
Myo9a A G 9: 59,870,815 I1285V probably benign Het
Ndel1 T C 11: 68,822,648 D321G possibly damaging Het
Nlrp4b T C 7: 10,715,217 V449A probably damaging Het
Olfr1386 T A 11: 49,470,434 Y94* probably null Het
Olfr1495 A G 19: 13,769,161 E273G probably benign Het
Olfr195 A C 16: 59,148,916 D22A probably benign Het
Olfr458 T C 6: 42,460,554 N155S possibly damaging Het
Olfr639 A T 7: 104,012,282 L140Q probably benign Het
Osbpl1a G A 18: 12,841,253 R459* probably null Het
Pabpc1l A C 2: 164,042,479 T379P probably damaging Het
Pde2a A T 7: 101,421,968 Q15L probably benign Het
Pdk1 A G 2: 71,895,741 N331S probably benign Het
Pfdn1 A T 18: 36,451,466 probably null Het
Pnliprp1 T A 19: 58,729,150 L9H probably damaging Het
Prl7a2 A T 13: 27,659,093 D242E possibly damaging Het
Prmt9 T A 8: 77,568,251 I408N possibly damaging Het
Psme4 G A 11: 30,848,105 R1366H probably benign Het
Pstpip1 A T 9: 56,128,650 D393V probably damaging Het
Rab5b A G 10: 128,683,193 probably null Het
Rap1gap2 G A 11: 74,393,119 R618C probably damaging Het
Rin1 A G 19: 5,050,773 probably benign Het
Sall3 G A 18: 80,973,754 P320S probably benign Het
Sdk1 A G 5: 142,081,716 T1124A probably damaging Het
Sirpb1c T A 3: 15,838,777 T88S possibly damaging Het
Slc35f6 T A 5: 30,656,777 I189N probably damaging Het
Spsb2 A T 6: 124,810,281 Q226L probably benign Het
Sugp1 G A 8: 70,070,150 R500H probably benign Het
Syne1 A G 10: 5,132,078 Y849H probably damaging Het
Tbck T A 3: 132,722,331 I249N possibly damaging Het
Tdrd6 A C 17: 43,624,204 F1984L probably benign Het
Tnxb T A 17: 34,671,340 V219E unknown Het
Tpst1 T A 5: 130,114,503 V294D probably damaging Het
Treml1 A G 17: 48,360,219 Q44R probably damaging Het
Trrap G A 5: 144,797,135 A933T probably benign Het
Vars2 A G 17: 35,658,250 L853P probably damaging Het
Vmn1r10 A T 6: 57,113,630 N69I possibly damaging Het
Vmn1r179 T A 7: 23,928,394 Y3* probably null Het
Vmn2r38 T A 7: 9,090,729 Y498F probably benign Het
Zc3h11a T C 1: 133,638,917 T179A probably damaging Het
Zmym2 A G 14: 56,902,712 T3A probably benign Het
Other mutations in Stab2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Stab2 APN 10 86869206 unclassified probably null
IGL00809:Stab2 APN 10 86848174 splice site probably benign
IGL00911:Stab2 APN 10 86969753 missense probably damaging 1.00
IGL01347:Stab2 APN 10 86901703 splice site probably null
IGL01411:Stab2 APN 10 86980008 splice site probably benign
IGL01503:Stab2 APN 10 86940613 splice site probably benign
IGL01599:Stab2 APN 10 86922895 missense probably damaging 1.00
IGL01635:Stab2 APN 10 86981128 missense probably benign 0.04
IGL01640:Stab2 APN 10 86954171 missense probably benign 0.09
IGL01671:Stab2 APN 10 86969277 missense possibly damaging 0.80
IGL02023:Stab2 APN 10 86871831 missense possibly damaging 0.67
IGL02075:Stab2 APN 10 86967650 missense possibly damaging 0.71
IGL02174:Stab2 APN 10 86859742 unclassified probably null
IGL02600:Stab2 APN 10 86954259 missense probably damaging 1.00
IGL02666:Stab2 APN 10 86850902 missense possibly damaging 0.67
IGL02668:Stab2 APN 10 86846163 splice site probably benign
IGL02709:Stab2 APN 10 86846165 splice site probably benign
IGL02728:Stab2 APN 10 86856556 missense possibly damaging 0.95
IGL02803:Stab2 APN 10 86950269 splice site probably benign
IGL02938:Stab2 APN 10 86871921 missense possibly damaging 0.77
IGL03033:Stab2 APN 10 86996803 critical splice donor site probably null
IGL03238:Stab2 APN 10 86855121 missense probably damaging 1.00
IGL03402:Stab2 APN 10 86969301 missense probably benign 0.03
3-1:Stab2 UTSW 10 86869177 missense probably damaging 0.96
F6893:Stab2 UTSW 10 86855171 missense probably damaging 1.00
K7371:Stab2 UTSW 10 86943289 critical splice donor site probably null
PIT4142001:Stab2 UTSW 10 86867175 missense possibly damaging 0.94
PIT4362001:Stab2 UTSW 10 86861435 nonsense probably null
R0015:Stab2 UTSW 10 86843617 missense probably benign
R0254:Stab2 UTSW 10 86897960 missense probably benign
R0310:Stab2 UTSW 10 86967613 splice site probably benign
R0333:Stab2 UTSW 10 86841627 missense probably benign
R0391:Stab2 UTSW 10 86947144 missense probably benign 0.27
R0400:Stab2 UTSW 10 86872610 missense probably damaging 1.00
R0433:Stab2 UTSW 10 86843491 splice site probably benign
R0440:Stab2 UTSW 10 86949928 missense probably benign 0.23
R0743:Stab2 UTSW 10 86887895 missense probably damaging 1.00
R0847:Stab2 UTSW 10 86969871 missense probably benign 0.00
R0883:Stab2 UTSW 10 86924450 splice site probably benign
R1078:Stab2 UTSW 10 86907133 splice site probably null
R1118:Stab2 UTSW 10 86885718 unclassified probably null
R1119:Stab2 UTSW 10 86859755 missense possibly damaging 0.51
R1179:Stab2 UTSW 10 86950301 missense probably damaging 0.98
R1440:Stab2 UTSW 10 86861367 unclassified probably null
R1550:Stab2 UTSW 10 86878926 missense probably benign 0.01
R1616:Stab2 UTSW 10 86885718 unclassified probably null
R1728:Stab2 UTSW 10 86938039 missense probably benign 0.41
R1768:Stab2 UTSW 10 87003008 missense probably damaging 1.00
R1772:Stab2 UTSW 10 86954234 missense probably benign 0.06
R1776:Stab2 UTSW 10 86957816 missense possibly damaging 0.92
R1784:Stab2 UTSW 10 86938039 missense probably benign 0.41
R1892:Stab2 UTSW 10 86938049 missense probably damaging 0.99
R1957:Stab2 UTSW 10 86861470 missense probably benign 0.13
R1972:Stab2 UTSW 10 86960316 missense probably damaging 0.99
R1975:Stab2 UTSW 10 86896496 critical splice donor site probably null
R1976:Stab2 UTSW 10 86896496 critical splice donor site probably null
R1996:Stab2 UTSW 10 87003031 missense probably damaging 1.00
R2085:Stab2 UTSW 10 86954159 missense probably damaging 1.00
R2149:Stab2 UTSW 10 86865040 nonsense probably null
R2169:Stab2 UTSW 10 86887862 missense probably damaging 1.00
R2201:Stab2 UTSW 10 86940639 missense probably benign 0.22
R2296:Stab2 UTSW 10 86954474 critical splice acceptor site probably null
R2297:Stab2 UTSW 10 86954474 critical splice acceptor site probably null
R2298:Stab2 UTSW 10 86954474 critical splice acceptor site probably null
R2326:Stab2 UTSW 10 86954474 critical splice acceptor site probably null
R2434:Stab2 UTSW 10 86969319 missense possibly damaging 0.78
R2519:Stab2 UTSW 10 86934840 splice site probably benign
R2696:Stab2 UTSW 10 86861499 missense probably benign 0.45
R2883:Stab2 UTSW 10 86967686 missense possibly damaging 0.92
R2923:Stab2 UTSW 10 86861461 missense probably damaging 1.00
R3711:Stab2 UTSW 10 86866708 missense probably damaging 1.00
R3787:Stab2 UTSW 10 86969277 missense possibly damaging 0.50
R3834:Stab2 UTSW 10 86949912 missense possibly damaging 0.87
R3970:Stab2 UTSW 10 86878886 missense probably damaging 0.97
R3979:Stab2 UTSW 10 86863456 missense possibly damaging 0.56
R4003:Stab2 UTSW 10 86858124 missense probably damaging 1.00
R4088:Stab2 UTSW 10 86922185 missense probably damaging 1.00
R4151:Stab2 UTSW 10 87002983 missense probably benign 0.12
R4190:Stab2 UTSW 10 86878944 missense probably damaging 0.98
R4556:Stab2 UTSW 10 86967679 missense possibly damaging 0.95
R4773:Stab2 UTSW 10 86907371 nonsense probably null
R4825:Stab2 UTSW 10 86947147 missense probably benign 0.08
R4865:Stab2 UTSW 10 86843500 unclassified probably null
R4871:Stab2 UTSW 10 86942235 missense probably damaging 0.99
R4943:Stab2 UTSW 10 86954162 missense probably damaging 0.99
R4981:Stab2 UTSW 10 86960223 missense probably benign
R4994:Stab2 UTSW 10 86949907 missense probably benign
R4999:Stab2 UTSW 10 86937909 missense probably damaging 0.97
R5061:Stab2 UTSW 10 86907385 missense probably damaging 1.00
R5072:Stab2 UTSW 10 86863558 missense probably benign 0.23
R5073:Stab2 UTSW 10 86863558 missense probably benign 0.23
R5074:Stab2 UTSW 10 86863558 missense probably benign 0.23
R5134:Stab2 UTSW 10 86871810 unclassified probably null
R5213:Stab2 UTSW 10 86907197 missense probably damaging 0.99
R5508:Stab2 UTSW 10 86960279 missense probably benign 0.01
R5530:Stab2 UTSW 10 86947162 missense probably benign 0.04
R5540:Stab2 UTSW 10 86848125 missense probably benign 0.30
R5839:Stab2 UTSW 10 86872691 missense probably damaging 0.97
R5949:Stab2 UTSW 10 86969849 missense possibly damaging 0.87
R6015:Stab2 UTSW 10 86938042 missense probably damaging 0.99
R6019:Stab2 UTSW 10 87003022 missense probably benign 0.00
R6116:Stab2 UTSW 10 86907190 missense probably damaging 1.00
R6131:Stab2 UTSW 10 86883778 unclassified probably null
R6209:Stab2 UTSW 10 86923003 missense possibly damaging 0.94
R6243:Stab2 UTSW 10 86907161 missense probably damaging 1.00
R6433:Stab2 UTSW 10 86901567 splice site probably null
R6787:Stab2 UTSW 10 86919084 missense probably benign 0.07
R6841:Stab2 UTSW 10 86942190 missense probably damaging 1.00
R6873:Stab2 UTSW 10 86861366 critical splice donor site probably null
R7025:Stab2 UTSW 10 86850837 missense probably damaging 1.00
R7043:Stab2 UTSW 10 86870246 missense probably damaging 0.99
R7047:Stab2 UTSW 10 86858152 missense probably damaging 1.00
R7214:Stab2 UTSW 10 86899841 missense probably damaging 0.99
R7271:Stab2 UTSW 10 87003108 splice site probably null
R7291:Stab2 UTSW 10 86946220 missense probably damaging 0.96
R7336:Stab2 UTSW 10 86969185 nonsense probably null
R7432:Stab2 UTSW 10 86885683 missense probably damaging 0.99
R7580:Stab2 UTSW 10 86869164 missense probably benign 0.00
R7622:Stab2 UTSW 10 86873902 missense possibly damaging 0.65
R7629:Stab2 UTSW 10 86883782 critical splice donor site probably null
R7658:Stab2 UTSW 10 86981135 missense probably benign 0.12
X0023:Stab2 UTSW 10 86922198 critical splice acceptor site probably null
X0025:Stab2 UTSW 10 86887816 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACTGCTTTCTGATTCAACAG -3'
(R):5'- TAACACTTCTGAGCCCTGCTG -3'

Sequencing Primer
(F):5'- TCTGATTCAACAGAAACAACTTTTTC -3'
(R):5'- GCTGTCTTGCTCATGGATAAGCC -3'
Posted On2019-05-15