Incidental Mutation 'R7107:Casc3'
ID 551267
Institutional Source Beutler Lab
Gene Symbol Casc3
Ensembl Gene ENSMUSG00000078676
Gene Name exon junction complex subunit
Synonyms Mln51, Btz
MMRRC Submission 045199-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.954) question?
Stock # R7107 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 98700634-98724633 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 98718413 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 491 (I491N)
Ref Sequence ENSEMBL: ENSMUSP00000130926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017384] [ENSMUST00000169695]
AlphaFold Q8K3W3
Predicted Effect possibly damaging
Transcript: ENSMUST00000017384
AA Change: I491N

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000017384
Gene: ENSMUSG00000078676
AA Change: I491N

DomainStartEndE-ValueType
low complexity region 18 62 N/A INTRINSIC
low complexity region 64 84 N/A INTRINSIC
low complexity region 89 109 N/A INTRINSIC
low complexity region 123 136 N/A INTRINSIC
Btz 138 246 1.02e-57 SMART
low complexity region 524 533 N/A INTRINSIC
low complexity region 586 614 N/A INTRINSIC
low complexity region 627 648 N/A INTRINSIC
low complexity region 669 684 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169695
AA Change: I491N

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000130926
Gene: ENSMUSG00000078676
AA Change: I491N

DomainStartEndE-ValueType
low complexity region 18 62 N/A INTRINSIC
low complexity region 64 84 N/A INTRINSIC
low complexity region 89 109 N/A INTRINSIC
low complexity region 123 136 N/A INTRINSIC
Btz 138 246 1.02e-57 SMART
low complexity region 524 533 N/A INTRINSIC
low complexity region 586 614 N/A INTRINSIC
low complexity region 627 648 N/A INTRINSIC
low complexity region 669 684 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a core component of the exon junction complex (EJC), a protein complex that is deposited on spliced mRNAs at exon-exon junctions and functions in nonsense-mediated mRNA decay (NMD). The encoded protein binds RNA and interacts with two other EJC core components. It is predominantly located in the cytoplasm, but shuttles into the nucleus where it localizes to nuclear speckles. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygosity for a null or hypomorphic allele causes embryonic and postnatal lethality, respectively. Compound heterozygous embryos are smaller and exhibit proportionately reduced brain size with fewer neurons and progenitors, but no apoptosis, largely due to developmental delay. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,867,299 (GRCm39) L253S probably damaging Het
Adgrv1 T C 13: 81,726,261 (GRCm39) E588G probably benign Het
Ahcy G A 2: 154,910,893 (GRCm39) A25V probably damaging Het
Ank2 A C 3: 126,797,631 (GRCm39) L710R probably damaging Het
Ap1b1 A G 11: 4,989,558 (GRCm39) T824A probably benign Het
Arap2 T A 5: 62,763,551 (GRCm39) H1531L probably damaging Het
Atosb A T 4: 43,036,434 (GRCm39) V99E probably benign Het
B3gnt7 T C 1: 86,233,495 (GRCm39) L247P probably damaging Het
Bcl6b A G 11: 70,117,396 (GRCm39) C409R probably damaging Het
Bicdl1 T C 5: 115,808,229 (GRCm39) H301R probably benign Het
Ccdc92b T A 11: 74,520,887 (GRCm39) L63Q probably damaging Het
Cep250 A G 2: 155,837,314 (GRCm39) T2319A probably benign Het
Chd1 T C 17: 15,981,628 (GRCm39) S1356P probably damaging Het
Chd8 A G 14: 52,450,129 (GRCm39) S1542P probably benign Het
Clec2m A G 6: 129,299,915 (GRCm39) C188R probably damaging Het
Cntnap4 A G 8: 113,542,120 (GRCm39) D751G probably damaging Het
Cpsf4l G A 11: 113,593,315 (GRCm39) R90C possibly damaging Het
Defa21 G A 8: 21,515,724 (GRCm39) A41T probably damaging Het
Dennd4a G T 9: 64,801,681 (GRCm39) L941F possibly damaging Het
Dnah12 G A 14: 26,500,869 (GRCm39) probably null Het
Dtx4 A T 19: 12,450,624 (GRCm39) C529* probably null Het
Entpd3 A G 9: 120,389,665 (GRCm39) Y317C probably damaging Het
Erp29 T A 5: 121,583,381 (GRCm39) I182F possibly damaging Het
Fam161a A G 11: 22,973,452 (GRCm39) R445G possibly damaging Het
Fam76a T A 4: 132,631,232 (GRCm39) M238L possibly damaging Het
Fn1 T C 1: 71,666,408 (GRCm39) Y875C probably damaging Het
Gnb2 A G 5: 137,528,444 (GRCm39) probably null Het
Hspg2 T C 4: 137,237,963 (GRCm39) S229P probably damaging Het
Ighv6-6 A G 12: 114,398,590 (GRCm39) S59P probably damaging Het
Itpkc C A 7: 26,927,702 (GRCm39) A71S probably benign Het
Kcnk10 G A 12: 98,485,002 (GRCm39) R45* probably null Het
Krcc1 A G 6: 71,261,198 (GRCm39) S77G probably benign Het
Lelp1 G A 3: 92,042,821 (GRCm39) T76I unknown Het
Lifr A T 15: 7,208,421 (GRCm39) I600F possibly damaging Het
Lrrk1 T A 7: 65,937,191 (GRCm39) D987V possibly damaging Het
Muc16 C T 9: 18,548,594 (GRCm39) D5900N probably benign Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,214,363 (GRCm39) probably null Het
Myo9a A G 9: 59,778,098 (GRCm39) I1285V probably benign Het
Ndel1 T C 11: 68,713,474 (GRCm39) D321G possibly damaging Het
Nlrp4b T C 7: 10,449,144 (GRCm39) V449A probably damaging Het
Or10q12 A G 19: 13,746,525 (GRCm39) E273G probably benign Het
Or2r11 T C 6: 42,437,488 (GRCm39) N155S possibly damaging Het
Or2y1c T A 11: 49,361,261 (GRCm39) Y94* probably null Het
Or51k1 A T 7: 103,661,489 (GRCm39) L140Q probably benign Het
Or5k3 A C 16: 58,969,279 (GRCm39) D22A probably benign Het
Osbpl1a G A 18: 12,974,310 (GRCm39) R459* probably null Het
Pabpc1l A C 2: 163,884,399 (GRCm39) T379P probably damaging Het
Pde2a A T 7: 101,071,175 (GRCm39) Q15L probably benign Het
Pdk1 A G 2: 71,726,085 (GRCm39) N331S probably benign Het
Pfdn1 A T 18: 36,584,519 (GRCm39) probably null Het
Pnliprp1 T A 19: 58,717,582 (GRCm39) L9H probably damaging Het
Prl7a2 A T 13: 27,843,076 (GRCm39) D242E possibly damaging Het
Prmt9 T A 8: 78,294,880 (GRCm39) I408N possibly damaging Het
Psme4 G A 11: 30,798,105 (GRCm39) R1366H probably benign Het
Pstpip1 A T 9: 56,035,934 (GRCm39) D393V probably damaging Het
Rab5b A G 10: 128,519,062 (GRCm39) probably null Het
Rap1gap2 G A 11: 74,283,945 (GRCm39) R618C probably damaging Het
Rin1 A G 19: 5,100,801 (GRCm39) probably benign Het
Sall3 G A 18: 81,016,969 (GRCm39) P320S probably benign Het
Sdk1 A G 5: 142,067,471 (GRCm39) T1124A probably damaging Het
Sirpb1c T A 3: 15,892,941 (GRCm39) T88S possibly damaging Het
Slc35f6 T A 5: 30,814,121 (GRCm39) I189N probably damaging Het
Slc49a3 T A 5: 108,596,581 (GRCm39) probably null Het
Spata31d1e T A 13: 59,889,997 (GRCm39) R608* probably null Het
Spsb2 A T 6: 124,787,244 (GRCm39) Q226L probably benign Het
Stab2 T C 10: 86,741,456 (GRCm39) D1221G possibly damaging Het
Sugp1 G A 8: 70,522,800 (GRCm39) R500H probably benign Het
Syne1 A G 10: 5,082,078 (GRCm39) Y849H probably damaging Het
Tbck T A 3: 132,428,092 (GRCm39) I249N possibly damaging Het
Tdrd6 A C 17: 43,935,095 (GRCm39) F1984L probably benign Het
Tnxb T A 17: 34,890,314 (GRCm39) V219E unknown Het
Tpst1 T A 5: 130,143,344 (GRCm39) V294D probably damaging Het
Treml1 A G 17: 48,667,247 (GRCm39) Q44R probably damaging Het
Trrap G A 5: 144,733,945 (GRCm39) A933T probably benign Het
Vars2 A G 17: 35,969,142 (GRCm39) L853P probably damaging Het
Vmn1r10 A T 6: 57,090,615 (GRCm39) N69I possibly damaging Het
Vmn1r179 T A 7: 23,627,819 (GRCm39) Y3* probably null Het
Vmn2r38 T A 7: 9,093,728 (GRCm39) Y498F probably benign Het
Zc3h11a T C 1: 133,566,655 (GRCm39) T179A probably damaging Het
Zmym2 A G 14: 57,140,169 (GRCm39) T3A probably benign Het
Other mutations in Casc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Casc3 APN 11 98,714,028 (GRCm39) missense possibly damaging 0.62
IGL01566:Casc3 APN 11 98,714,227 (GRCm39) critical splice donor site probably null
IGL01901:Casc3 APN 11 98,713,947 (GRCm39) missense probably damaging 1.00
IGL02345:Casc3 APN 11 98,718,390 (GRCm39) splice site probably benign
IGL02875:Casc3 APN 11 98,712,378 (GRCm39) missense probably damaging 1.00
IGL02964:Casc3 APN 11 98,719,749 (GRCm39) missense probably damaging 0.96
R0147:Casc3 UTSW 11 98,713,325 (GRCm39) missense possibly damaging 0.89
R0195:Casc3 UTSW 11 98,712,319 (GRCm39) missense probably damaging 0.99
R0763:Casc3 UTSW 11 98,722,144 (GRCm39) missense probably damaging 1.00
R1581:Casc3 UTSW 11 98,713,644 (GRCm39) missense possibly damaging 0.66
R2021:Casc3 UTSW 11 98,712,332 (GRCm39) missense probably benign 0.01
R4380:Casc3 UTSW 11 98,713,857 (GRCm39) missense possibly damaging 0.67
R4612:Casc3 UTSW 11 98,713,784 (GRCm39) missense probably benign 0.13
R4988:Casc3 UTSW 11 98,712,700 (GRCm39) splice site probably null
R5079:Casc3 UTSW 11 98,701,252 (GRCm39) intron probably benign
R5442:Casc3 UTSW 11 98,712,297 (GRCm39) missense probably damaging 0.99
R5511:Casc3 UTSW 11 98,701,740 (GRCm39) nonsense probably null
R5873:Casc3 UTSW 11 98,712,270 (GRCm39) missense unknown
R6041:Casc3 UTSW 11 98,719,385 (GRCm39) missense probably damaging 1.00
R6685:Casc3 UTSW 11 98,713,356 (GRCm39) missense probably damaging 0.99
R7030:Casc3 UTSW 11 98,713,359 (GRCm39) missense possibly damaging 0.74
R7594:Casc3 UTSW 11 98,712,311 (GRCm39) missense probably benign 0.04
R7659:Casc3 UTSW 11 98,700,699 (GRCm39) missense unknown
R7660:Casc3 UTSW 11 98,700,699 (GRCm39) missense unknown
R8443:Casc3 UTSW 11 98,713,607 (GRCm39) missense probably damaging 1.00
R8444:Casc3 UTSW 11 98,713,607 (GRCm39) missense probably damaging 1.00
R8491:Casc3 UTSW 11 98,713,977 (GRCm39) missense probably benign 0.27
R8516:Casc3 UTSW 11 98,713,607 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGACAGTTTTAAAGGATGAATACAC -3'
(R):5'- GCCATCTGAATGAAGACAATCCA -3'

Sequencing Primer
(F):5'- CTGGAACTCACTTTGTAGACCAGG -3'
(R):5'- CACATTAACTAGGTCTGGACGTG -3'
Posted On 2019-05-15