Mutagenetix > Incidental Mutation

Incidental Mutation 'R7107:Dnah12'

551275

Institutional Source

Beutler Lab

Gene Symbol

Dnah12

Ensembl Gene

ENSMUSG00000021879

Gene Name

dynein, axonemal, heavy chain 12

Synonyms

DHC3, Hdhc3, HL-19, Dnahc7l, 4921531P07Rik, LOC380889, DLP12, HL19, Dnahc12

MMRRC Submission

045199-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.185) question?

Stock #

R7107 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

26693274-26891703 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

G to A at 26778912 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000022433 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022433]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000022433

SMART Domains

Protein: ENSMUSP00000022433
Gene: ENSMUSG00000021879

Domain	Start	End	E-Value	Type
low complexity region	127	140	N/A	INTRINSIC
coiled coil region	588	666	N/A	INTRINSIC
Pfam:DHC_N2	676	1113	1.1e-147	PFAM
AAA	1268	1407	1.15e0	SMART
Pfam:AAA_5	1552	1695	1.5e-7	PFAM
Blast:AAA	1709	1827	2e-24	BLAST
Blast:AAA	1848	1898	1e-16	BLAST
AAA	1903	2051	5.42e-4	SMART
Pfam:AAA_8	2238	2316	2e-18	PFAM

Meta Mutation Damage Score

0.9489

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

99% (78/79)

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	T	A	13: 59,742,183	R608*	probably null	Het
4922502D21Rik	A	G	6: 129,322,952	C188R	probably damaging	Het
Abca8b	A	G	11: 109,976,473	L253S	probably damaging	Het
Adgrv1	T	C	13: 81,578,142	E588G	probably benign	Het
Ahcy	G	A	2: 155,068,973	A25V	probably damaging	Het
Ank2	A	C	3: 127,003,982	L710R	probably damaging	Het
Ap1b1	A	G	11: 5,039,558	T824A	probably benign	Het
Arap2	T	A	5: 62,606,208	H1531L	probably damaging	Het
B3gnt7	T	C	1: 86,305,773	L247P	probably damaging	Het
Bcl6b	A	G	11: 70,226,570	C409R	probably damaging	Het
Bicdl1	T	C	5: 115,670,170	H301R	probably benign	Het
Casc3	T	A	11: 98,827,587	I491N	possibly damaging	Het
Ccdc92b	T	A	11: 74,630,061	L63Q	probably damaging	Het
Cep250	A	G	2: 155,995,394	T2319A	probably benign	Het
Chd1	T	C	17: 15,761,366	S1356P	probably damaging	Het
Chd8	A	G	14: 52,212,672	S1542P	probably benign	Het
Cntnap4	A	G	8: 112,815,488	D751G	probably damaging	Het
Cpsf4l	G	A	11: 113,702,489	R90C	possibly damaging	Het
Defa21	G	A	8: 21,025,708	A41T	probably damaging	Het
Dennd4a	G	T	9: 64,894,399	L941F	possibly damaging	Het
Dtx4	A	T	19: 12,473,260	C529*	probably null	Het
Entpd3	A	G	9: 120,560,599	Y317C	probably damaging	Het
Erp29	T	A	5: 121,445,318	I182F	possibly damaging	Het
Fam161a	A	G	11: 23,023,452	R445G	possibly damaging	Het
Fam214b	A	T	4: 43,036,434	V99E	probably benign	Het
Fam76a	T	A	4: 132,903,921	M238L	possibly damaging	Het
Fn1	T	C	1: 71,627,249	Y875C	probably damaging	Het
Gnb2	A	G	5: 137,530,182		probably null	Het
Hspg2	T	C	4: 137,510,652	S229P	probably damaging	Het
Ighv6-6	A	G	12: 114,434,970	S59P	probably damaging	Het
Itpkc	C	A	7: 27,228,277	A71S	probably benign	Het
Kcnk10	G	A	12: 98,518,743	R45*	probably null	Het
Krcc1	A	G	6: 71,284,214	S77G	probably benign	Het
Lelp1	G	A	3: 92,135,514	T76I	unknown	Het
Lifr	A	T	15: 7,178,940	I600F	possibly damaging	Het
Lrrk1	T	A	7: 66,287,443	D987V	possibly damaging	Het
Mfsd7a	T	A	5: 108,448,715		probably null	Het
Muc16	C	T	9: 18,637,298	D5900N	probably benign	Het
Muc6	AGGCGCAGAAACCCTGGC	AGGC	7: 141,634,450		probably null	Het
Myo9a	A	G	9: 59,870,815	I1285V	probably benign	Het
Ndel1	T	C	11: 68,822,648	D321G	possibly damaging	Het
Nlrp4b	T	C	7: 10,715,217	V449A	probably damaging	Het
Olfr1386	T	A	11: 49,470,434	Y94*	probably null	Het
Olfr1495	A	G	19: 13,769,161	E273G	probably benign	Het
Olfr195	A	C	16: 59,148,916	D22A	probably benign	Het
Olfr458	T	C	6: 42,460,554	N155S	possibly damaging	Het
Olfr639	A	T	7: 104,012,282	L140Q	probably benign	Het
Osbpl1a	G	A	18: 12,841,253	R459*	probably null	Het
Pabpc1l	A	C	2: 164,042,479	T379P	probably damaging	Het
Pde2a	A	T	7: 101,421,968	Q15L	probably benign	Het
Pdk1	A	G	2: 71,895,741	N331S	probably benign	Het
Pfdn1	A	T	18: 36,451,466		probably null	Het
Pnliprp1	T	A	19: 58,729,150	L9H	probably damaging	Het
Prl7a2	A	T	13: 27,659,093	D242E	possibly damaging	Het
Prmt9	T	A	8: 77,568,251	I408N	possibly damaging	Het
Psme4	G	A	11: 30,848,105	R1366H	probably benign	Het
Pstpip1	A	T	9: 56,128,650	D393V	probably damaging	Het
Rab5b	A	G	10: 128,683,193		probably null	Het
Rap1gap2	G	A	11: 74,393,119	R618C	probably damaging	Het
Rin1	A	G	19: 5,050,773		probably benign	Het
Sall3	G	A	18: 80,973,754	P320S	probably benign	Het
Sdk1	A	G	5: 142,081,716	T1124A	probably damaging	Het
Sirpb1c	T	A	3: 15,838,777	T88S	possibly damaging	Het
Slc35f6	T	A	5: 30,656,777	I189N	probably damaging	Het
Spsb2	A	T	6: 124,810,281	Q226L	probably benign	Het
Stab2	T	C	10: 86,905,592	D1221G	possibly damaging	Het
Sugp1	G	A	8: 70,070,150	R500H	probably benign	Het
Syne1	A	G	10: 5,132,078	Y849H	probably damaging	Het
Tbck	T	A	3: 132,722,331	I249N	possibly damaging	Het
Tdrd6	A	C	17: 43,624,204	F1984L	probably benign	Het
Tnxb	T	A	17: 34,671,340	V219E	unknown	Het
Tpst1	T	A	5: 130,114,503	V294D	probably damaging	Het
Treml1	A	G	17: 48,360,219	Q44R	probably damaging	Het
Trrap	G	A	5: 144,797,135	A933T	probably benign	Het
Vars2	A	G	17: 35,658,250	L853P	probably damaging	Het
Vmn1r10	A	T	6: 57,113,630	N69I	possibly damaging	Het
Vmn1r179	T	A	7: 23,928,394	Y3*	probably null	Het
Vmn2r38	T	A	7: 9,090,729	Y498F	probably benign	Het
Zc3h11a	T	C	1: 133,638,917	T179A	probably damaging	Het
Zmym2	A	G	14: 56,902,712	T3A	probably benign	Het

Other mutations in Dnah12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01412:Dnah12	APN	14	26771005	missense	probably damaging	1.00
IGL01602:Dnah12	APN	14	26710275	splice site	probably benign
IGL01681:Dnah12	APN	14	26722160	missense	probably benign
IGL02082:Dnah12	APN	14	26707162	missense	possibly damaging	0.79
IGL02140:Dnah12	APN	14	26716577	missense	probably benign	0.20
IGL02170:Dnah12	APN	14	26773112	missense	probably damaging	0.99
IGL02174:Dnah12	APN	14	26706917	missense	probably benign	0.00
IGL02367:Dnah12	APN	14	26709161	missense	probably benign	0.30
IGL02418:Dnah12	APN	14	26773722	missense	probably damaging	1.00
IGL03039:Dnah12	APN	14	26724512	missense	probably benign	0.02
IGL03066:Dnah12	APN	14	26697398	missense	probably benign	0.06
drippings	UTSW	14	26854804	missense	probably damaging	1.00
grueben	UTSW	14	26878079	missense	probably damaging	1.00
BB010:Dnah12	UTSW	14	26766115	missense	probably benign	0.00
BB020:Dnah12	UTSW	14	26766115	missense	probably benign	0.00
F5770:Dnah12	UTSW	14	26773093	missense	possibly damaging	0.95
FR4304:Dnah12	UTSW	14	26849385	missense	probably damaging	1.00
FR4340:Dnah12	UTSW	14	26849385	missense	probably damaging	1.00
FR4342:Dnah12	UTSW	14	26849385	missense	probably damaging	1.00
FR4589:Dnah12	UTSW	14	26849385	missense	probably damaging	1.00
IGL03055:Dnah12	UTSW	14	26872740	missense	probably damaging	1.00
LCD18:Dnah12	UTSW	14	26849385	missense	probably damaging	1.00
R0003:Dnah12	UTSW	14	26772644	missense	probably damaging	1.00
R0110:Dnah12	UTSW	14	26798899	missense	probably damaging	1.00
R0302:Dnah12	UTSW	14	26799999	missense	probably damaging	1.00
R0355:Dnah12	UTSW	14	26706117	splice site	probably null
R0364:Dnah12	UTSW	14	26724473	missense	probably benign	0.10
R0469:Dnah12	UTSW	14	26798899	missense	probably damaging	1.00
R0558:Dnah12	UTSW	14	26709310	missense	probably benign	0.00
R0709:Dnah12	UTSW	14	26884265	splice site	probably benign
R0734:Dnah12	UTSW	14	26800013	missense	probably benign	0.00
R1273:Dnah12	UTSW	14	26739220	nonsense	probably null
R1496:Dnah12	UTSW	14	26710248	missense	probably benign
R1503:Dnah12	UTSW	14	26773692	missense	probably damaging	1.00
R1535:Dnah12	UTSW	14	26816322	missense	possibly damaging	0.91
R1608:Dnah12	UTSW	14	26766190	missense	probably damaging	1.00
R1682:Dnah12	UTSW	14	26778883	missense	possibly damaging	0.71
R1758:Dnah12	UTSW	14	26766114	missense	probably benign	0.02
R1826:Dnah12	UTSW	14	26711019	missense	probably benign	0.01
R1829:Dnah12	UTSW	14	26773023	missense	probably damaging	1.00
R1829:Dnah12	UTSW	14	26800075	missense	probably damaging	1.00
R1862:Dnah12	UTSW	14	26697398	missense	probably benign	0.06
R1862:Dnah12	UTSW	14	26709257	missense	probably benign	0.30
R1913:Dnah12	UTSW	14	26792264	splice site	probably null
R1933:Dnah12	UTSW	14	26734495	missense	probably damaging	0.98
R2006:Dnah12	UTSW	14	26814459	missense	possibly damaging	0.95
R2045:Dnah12	UTSW	14	26781528	missense	probably null	1.00
R2113:Dnah12	UTSW	14	26766141	missense	probably damaging	1.00
R2125:Dnah12	UTSW	14	26724458	nonsense	probably null
R2126:Dnah12	UTSW	14	26724458	nonsense	probably null
R2207:Dnah12	UTSW	14	26781787	missense	probably damaging	0.99
R2213:Dnah12	UTSW	14	26739330	missense	probably benign	0.06
R2511:Dnah12	UTSW	14	26769950	missense	possibly damaging	0.65
R2875:Dnah12	UTSW	14	26693470	missense	probably benign	0.04
R2875:Dnah12	UTSW	14	26876950	missense	probably benign	0.05
R3551:Dnah12	UTSW	14	26770972	missense	probably benign	0.01
R3713:Dnah12	UTSW	14	26812790	missense	probably benign
R3729:Dnah12	UTSW	14	26706065	missense	probably benign	0.02
R3799:Dnah12	UTSW	14	26770923	missense	probably damaging	1.00
R3846:Dnah12	UTSW	14	26710211	missense	probably benign	0.00
R3892:Dnah12	UTSW	14	26856616	missense	probably benign	0.03
R3921:Dnah12	UTSW	14	26771051	missense	probably damaging	1.00
R3940:Dnah12	UTSW	14	26723599	missense	probably benign
R4065:Dnah12	UTSW	14	26770448	missense	probably benign	0.02
R4113:Dnah12	UTSW	14	26693567	missense	probably damaging	0.98
R4249:Dnah12	UTSW	14	26709186	missense	possibly damaging	0.70
R4259:Dnah12	UTSW	14	26798926	missense	probably benign	0.01
R4260:Dnah12	UTSW	14	26798926	missense	probably benign	0.01
R4348:Dnah12	UTSW	14	26814541	missense	possibly damaging	0.94
R4457:Dnah12	UTSW	14	26815507	missense	probably damaging	1.00
R4490:Dnah12	UTSW	14	26734603	missense	possibly damaging	0.67
R4491:Dnah12	UTSW	14	26734603	missense	possibly damaging	0.67
R4494:Dnah12	UTSW	14	26871855	missense	probably damaging	0.99
R4523:Dnah12	UTSW	14	26770022	missense	probably damaging	0.97
R4523:Dnah12	UTSW	14	26876958	missense	possibly damaging	0.83
R4546:Dnah12	UTSW	14	26773014	missense	probably damaging	1.00
R4584:Dnah12	UTSW	14	26772594	missense	probably damaging	1.00
R4624:Dnah12	UTSW	14	26735758	missense	possibly damaging	0.82
R4689:Dnah12	UTSW	14	26706839	missense	probably benign	0.00
R4727:Dnah12	UTSW	14	26872317	missense	probably damaging	1.00
R4732:Dnah12	UTSW	14	26781784	missense	probably damaging	1.00
R4733:Dnah12	UTSW	14	26781784	missense	probably damaging	1.00
R4851:Dnah12	UTSW	14	26716629	nonsense	probably null
R4879:Dnah12	UTSW	14	26718046	critical splice donor site	probably null
R4893:Dnah12	UTSW	14	26710170	missense	possibly damaging	0.66
R4915:Dnah12	UTSW	14	26734570	missense	probably damaging	1.00
R4927:Dnah12	UTSW	14	26861805	nonsense	probably null
R4939:Dnah12	UTSW	14	26891524	missense	probably damaging	1.00
R4962:Dnah12	UTSW	14	26716700	missense	probably benign	0.00
R5011:Dnah12	UTSW	14	26710171	missense	probably benign	0.03
R5013:Dnah12	UTSW	14	26710171	missense	probably benign	0.03
R5043:Dnah12	UTSW	14	26884190	missense	probably damaging	1.00
R5049:Dnah12	UTSW	14	26735697	missense	probably benign	0.09
R5122:Dnah12	UTSW	14	26718000	missense	probably benign	0.00
R5135:Dnah12	UTSW	14	26770477	missense	probably damaging	0.99
R5149:Dnah12	UTSW	14	26850926	nonsense	probably null
R5154:Dnah12	UTSW	14	26849363	missense	probably benign	0.12
R5206:Dnah12	UTSW	14	26769985	missense	probably damaging	1.00
R5307:Dnah12	UTSW	14	26693486	missense	possibly damaging	0.49
R5330:Dnah12	UTSW	14	26773830	missense	probably damaging	1.00
R5335:Dnah12	UTSW	14	26879738	missense	probably damaging	1.00
R5339:Dnah12	UTSW	14	26814537	missense	possibly damaging	0.83
R5354:Dnah12	UTSW	14	26774342	splice site	probably null
R5389:Dnah12	UTSW	14	26735749	missense	probably damaging	1.00
R5434:Dnah12	UTSW	14	26859299	missense	probably damaging	1.00
R5466:Dnah12	UTSW	14	26771050	missense	probably damaging	1.00
R5655:Dnah12	UTSW	14	26710269	missense	probably benign	0.01
R5681:Dnah12	UTSW	14	26815495	missense	probably benign	0.32
R5824:Dnah12	UTSW	14	26770518	critical splice donor site	probably null
R5863:Dnah12	UTSW	14	26854921	missense	probably damaging	1.00
R5890:Dnah12	UTSW	14	26706884	missense	probably benign	0.09
R5912:Dnah12	UTSW	14	26770008	nonsense	probably null
R5916:Dnah12	UTSW	14	26706918	missense	possibly damaging	0.92
R5941:Dnah12	UTSW	14	26706867	missense	probably benign	0.00
R5987:Dnah12	UTSW	14	26886871	missense	possibly damaging	0.54
R5992:Dnah12	UTSW	14	26697341	missense	probably benign	0.04
R6132:Dnah12	UTSW	14	26717911	missense	probably damaging	1.00
R6136:Dnah12	UTSW	14	26875270	missense	probably damaging	0.99
R6158:Dnah12	UTSW	14	26773685	missense	possibly damaging	0.95
R6183:Dnah12	UTSW	14	26861769	missense	probably damaging	1.00
R6191:Dnah12	UTSW	14	26710257	missense	probably benign	0.03
R6235:Dnah12	UTSW	14	26854804	missense	probably damaging	1.00
R6277:Dnah12	UTSW	14	26770482	missense	probably damaging	1.00
R6332:Dnah12	UTSW	14	26717974	missense	probably damaging	0.99
R6334:Dnah12	UTSW	14	26706834	missense	possibly damaging	0.51
R6443:Dnah12	UTSW	14	26878051	missense	probably benign	0.06
R6480:Dnah12	UTSW	14	26872455	missense	probably damaging	1.00
R6530:Dnah12	UTSW	14	26735710	missense	probably damaging	1.00
R6678:Dnah12	UTSW	14	26735692	missense	probably damaging	1.00
R6709:Dnah12	UTSW	14	26872749	missense	probably damaging	1.00
R6724:Dnah12	UTSW	14	26796223	missense	probably benign	0.02
R6745:Dnah12	UTSW	14	26707228	missense	probably damaging	0.99
R6788:Dnah12	UTSW	14	26801513	missense	probably damaging	0.99
R6894:Dnah12	UTSW	14	26735749	missense	probably damaging	1.00
R6912:Dnah12	UTSW	14	26878079	missense	probably damaging	1.00
R6982:Dnah12	UTSW	14	26799076	splice site	probably null
R7001:Dnah12	UTSW	14	26879724	missense	probably damaging	0.99
R7002:Dnah12	UTSW	14	26876998	missense	probably damaging	1.00
R7017:Dnah12	UTSW	14	26735680	missense	probably benign
R7108:Dnah12	UTSW	14	26778912	critical splice donor site	probably null
R7121:Dnah12	UTSW	14	26778912	critical splice donor site	probably null
R7122:Dnah12	UTSW	14	26778912	critical splice donor site	probably null
R7135:Dnah12	UTSW	14	26778912	critical splice donor site	probably null
R7135:Dnah12	UTSW	14	26801413	missense	probably damaging	0.99
R7150:Dnah12	UTSW	14	26861732	missense	probably damaging	0.99
R7188:Dnah12	UTSW	14	26814413	missense	probably benign	0.04
R7201:Dnah12	UTSW	14	26814622	missense	probably benign	0.08
R7202:Dnah12	UTSW	14	26778912	critical splice donor site	probably null
R7204:Dnah12	UTSW	14	26778912	critical splice donor site	probably null
R7204:Dnah12	UTSW	14	26781485	missense	probably damaging	0.99
R7205:Dnah12	UTSW	14	26778912	critical splice donor site	probably null
R7206:Dnah12	UTSW	14	26778912	critical splice donor site	probably null
R7219:Dnah12	UTSW	14	26854880	missense	probably damaging	0.99
R7337:Dnah12	UTSW	14	26766577	splice site	probably null
R7339:Dnah12	UTSW	14	26872320	missense	probably benign
R7363:Dnah12	UTSW	14	26724611	missense	probably benign
R7426:Dnah12	UTSW	14	26724626	missense	probably benign	0.01
R7472:Dnah12	UTSW	14	26856635	missense	probably benign	0.01
R7579:Dnah12	UTSW	14	26770503	missense	probably benign	0.05
R7655:Dnah12	UTSW	14	26859316	missense	probably benign	0.21
R7656:Dnah12	UTSW	14	26859316	missense	probably benign	0.21
R7694:Dnah12	UTSW	14	26781380	missense	probably damaging	1.00
R7730:Dnah12	UTSW	14	26785933	missense	probably damaging	1.00
R7837:Dnah12	UTSW	14	26796219	missense	probably benign	0.01
R7855:Dnah12	UTSW	14	26829329	missense	probably benign	0.14
R7870:Dnah12	UTSW	14	26856529	missense	probably benign	0.00
R7920:Dnah12	UTSW	14	26856542	missense	possibly damaging	0.58
R7933:Dnah12	UTSW	14	26766115	missense	probably benign	0.00
R7956:Dnah12	UTSW	14	26709272	missense	probably damaging	0.96
R8192:Dnah12	UTSW	14	26706881	missense	probably benign
R8263:Dnah12	UTSW	14	26891464	missense	noncoding transcript
R8287:Dnah12	UTSW	14	26812603	missense	probably benign
R8336:Dnah12	UTSW	14	26711065	missense	probably benign	0.01
R8362:Dnah12	UTSW	14	26854831	missense	probably damaging	1.00
R8392:Dnah12	UTSW	14	26885912	missense	probably benign
R8458:Dnah12	UTSW	14	26826892	critical splice acceptor site	probably null
R8481:Dnah12	UTSW	14	26853796	missense	probably benign	0.02
R8551:Dnah12	UTSW	14	26774270	missense	probably damaging	0.97
R8669:Dnah12	UTSW	14	26830625	splice site	probably benign
R8698:Dnah12	UTSW	14	26707263	missense	probably benign	0.02
R8709:Dnah12	UTSW	14	26693602	missense	probably benign	0.00
R8778:Dnah12	UTSW	14	26734563	missense	probably benign	0.29
R9049:Dnah12	UTSW	14	26722120	missense	probably benign	0.00
R9087:Dnah12	UTSW	14	26824546	missense	probably damaging	1.00
R9099:Dnah12	UTSW	14	26770368	missense	probably benign	0.31
R9153:Dnah12	UTSW	14	26814612	missense	probably damaging	1.00
R9177:Dnah12	UTSW	14	26849298	missense	possibly damaging	0.84
R9214:Dnah12	UTSW	14	26723905	missense	probably benign	0.02
R9268:Dnah12	UTSW	14	26849298	missense	possibly damaging	0.84
R9274:Dnah12	UTSW	14	26815417	missense	probably benign	0.00
R9293:Dnah12	UTSW	14	26773059	missense	probably benign
R9322:Dnah12	UTSW	14	26770977	missense	possibly damaging	0.75
R9353:Dnah12	UTSW	14	26856550	missense	probably damaging	1.00
R9506:Dnah12	UTSW	14	26792211	missense	probably benign	0.00
R9518:Dnah12	UTSW	14	26773756	missense	probably damaging	1.00
R9524:Dnah12	UTSW	14	26850537	missense	probably null	0.91
R9562:Dnah12	UTSW	14	26875324	missense	possibly damaging	0.58
R9565:Dnah12	UTSW	14	26875324	missense	possibly damaging	0.58
R9573:Dnah12	UTSW	14	26693464	missense	probably benign
R9581:Dnah12	UTSW	14	26770028	missense	probably damaging	1.00
R9689:Dnah12	UTSW	14	26868914	missense	probably null	1.00
R9727:Dnah12	UTSW	14	26801553	nonsense	probably null
V7580:Dnah12	UTSW	14	26773093	missense	possibly damaging	0.95
V7581:Dnah12	UTSW	14	26773093	missense	possibly damaging	0.95
X0018:Dnah12	UTSW	14	26814480	missense	probably damaging	1.00
X0027:Dnah12	UTSW	14	26816288	missense	probably damaging	1.00
X0065:Dnah12	UTSW	14	26814645	missense	possibly damaging	0.93
Z1177:Dnah12	UTSW	14	26875215	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTATGGTATGAAGGGTTATCTAGC -3'
(R):5'- TAGGATTAGAGGTGTGAATGCC -3'

Sequencing Primer
(F):5'- TGGCAAACACCATTAGAATTGTTC -3'
(R):5'- AGGTGTGAATGCCTCCTCTGC -3'

Posted On

2019-05-15