Incidental Mutation 'R0597:Cobl'
ID55128
Institutional Source Beutler Lab
Gene Symbol Cobl
Ensembl Gene ENSMUSG00000020173
Gene Namecordon-bleu WH2 repeat
SynonymsC530045F18Rik
MMRRC Submission 038786-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0597 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location12236608-12464960 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12254699 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 586 (T586A)
Ref Sequence ENSEMBL: ENSMUSP00000105277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046755] [ENSMUST00000109650] [ENSMUST00000109651] [ENSMUST00000172919] [ENSMUST00000172956] [ENSMUST00000174874]
Predicted Effect probably benign
Transcript: ENSMUST00000046755
AA Change: T668A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000045693
Gene: ENSMUSG00000020173
AA Change: T668A

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
Pfam:Cobl 144 235 2.2e-46 PFAM
low complexity region 328 333 N/A INTRINSIC
low complexity region 360 376 N/A INTRINSIC
low complexity region 408 433 N/A INTRINSIC
low complexity region 468 482 N/A INTRINSIC
low complexity region 526 541 N/A INTRINSIC
coiled coil region 564 589 N/A INTRINSIC
WH2 1185 1205 1.32e0 SMART
WH2 1225 1245 6.36e-3 SMART
low complexity region 1276 1296 N/A INTRINSIC
WH2 1313 1333 3.91e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109650
AA Change: T586A

PolyPhen 2 Score 0.240 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000105277
Gene: ENSMUSG00000020173
AA Change: T586A

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
Pfam:Cobl 182 260 1.6e-40 PFAM
low complexity region 303 308 N/A INTRINSIC
low complexity region 335 351 N/A INTRINSIC
low complexity region 386 400 N/A INTRINSIC
low complexity region 444 459 N/A INTRINSIC
coiled coil region 482 507 N/A INTRINSIC
WH2 1103 1123 1.32e0 SMART
WH2 1143 1163 6.36e-3 SMART
low complexity region 1194 1214 N/A INTRINSIC
WH2 1231 1251 3.91e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109651
AA Change: T643A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105278
Gene: ENSMUSG00000020173
AA Change: T643A

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
Pfam:Cobl 182 260 1.2e-40 PFAM
low complexity region 303 308 N/A INTRINSIC
low complexity region 335 351 N/A INTRINSIC
low complexity region 383 408 N/A INTRINSIC
low complexity region 443 457 N/A INTRINSIC
low complexity region 501 516 N/A INTRINSIC
coiled coil region 539 564 N/A INTRINSIC
WH2 1160 1180 1.32e0 SMART
WH2 1200 1220 6.36e-3 SMART
low complexity region 1251 1271 N/A INTRINSIC
WH2 1288 1308 3.91e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172919
SMART Domains Protein: ENSMUSP00000133669
Gene: ENSMUSG00000020173

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
Pfam:Cobl 182 260 2.6e-41 PFAM
low complexity region 328 333 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172956
SMART Domains Protein: ENSMUSP00000134372
Gene: ENSMUSG00000020173

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
Pfam:Cobl 182 260 2.4e-41 PFAM
low complexity region 303 308 N/A INTRINSIC
low complexity region 335 351 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174874
AA Change: T661A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133470
Gene: ENSMUSG00000020173
AA Change: T661A

DomainStartEndE-ValueType
low complexity region 6 23 N/A INTRINSIC
Pfam:Cobl 175 253 1.2e-40 PFAM
low complexity region 321 326 N/A INTRINSIC
low complexity region 353 369 N/A INTRINSIC
low complexity region 401 426 N/A INTRINSIC
low complexity region 461 475 N/A INTRINSIC
low complexity region 519 534 N/A INTRINSIC
coiled coil region 557 582 N/A INTRINSIC
WH2 1178 1198 1.32e0 SMART
WH2 1218 1238 6.36e-3 SMART
low complexity region 1269 1289 N/A INTRINSIC
WH2 1306 1326 3.91e-3 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 99.0%
  • 10x: 97.4%
  • 20x: 94.1%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains WH2 domains (WASP, Wiskott-Aldrich syndrome protein, homology domain-2) that interact with actin. The encoded actin regulator protein is required for growth and assembly of brush border microvilli that play a role in maintaining intestinal homeostasis. A similar protein in mouse functions in midbrain neural tube closure. A pseudogene of this gene is located on chromosome X. [provided by RefSeq, Oct 2016]
PHENOTYPE: Animals homozygous for this mutation do not display a phenotype. However, the allele exacerbates the neural tube defects seen in the loop tail mouse. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy10 T C 1: 165,525,062 probably null Het
Anxa11 T C 14: 25,874,228 I221T probably damaging Het
Arhgap33 C G 7: 30,526,446 R565P probably damaging Het
Bmpr2 T C 1: 59,841,425 probably benign Het
Btn2a2 T A 13: 23,486,410 H51L probably benign Het
Casz1 T C 4: 148,944,394 S1099P probably benign Het
Cnot4 A G 6: 35,051,503 S393P possibly damaging Het
Cntnap5a T C 1: 116,184,461 probably benign Het
Crocc T C 4: 141,019,913 K1528R probably benign Het
Crocc A G 4: 141,017,071 L1838P probably benign Het
Dact2 A G 17: 14,197,041 V299A probably benign Het
Dapk1 C A 13: 60,761,384 N1270K probably benign Het
Ddx41 T C 13: 55,533,006 Y375C probably damaging Het
Dock5 T A 14: 67,784,934 probably null Het
Dyrk4 T G 6: 126,886,649 probably null Het
Eno1b T C 18: 48,047,739 I328T probably benign Het
Fam210b A G 2: 172,345,853 probably benign Het
Fbxl13 A G 5: 21,614,714 I229T probably benign Het
Fbxo39 A G 11: 72,316,921 D33G probably damaging Het
Fbxw11 A G 11: 32,720,496 E120G probably damaging Het
Fbxw2 A T 2: 34,811,020 L261Q probably damaging Het
Gm13084 G T 4: 143,812,652 N90K probably damaging Het
Gm5800 A C 14: 51,716,004 N51K probably benign Het
Gm6899 A G 11: 26,593,768 probably benign Het
Gm9745 C A 13: 8,940,766 probably benign Het
Gpx8 T C 13: 113,045,501 T133A possibly damaging Het
Grin3a C T 4: 49,665,351 V1095M probably damaging Het
Grip2 T C 6: 91,796,197 probably benign Het
Hacd4 A G 4: 88,437,520 F43L probably damaging Het
Hif1a T G 12: 73,942,275 S645R probably benign Het
Hipk3 A G 2: 104,433,637 S839P possibly damaging Het
Il16 A T 7: 83,677,975 probably benign Het
Il3ra T A 14: 14,351,166 probably null Het
Il5ra A G 6: 106,744,335 M1T probably null Het
Klra2 G A 6: 131,220,185 R251C probably benign Het
Lamc2 C T 1: 153,133,621 V813M probably benign Het
Lbr A G 1: 181,832,213 V139A probably benign Het
Lrp5 T C 19: 3,600,777 D1219G possibly damaging Het
Map3k6 C T 4: 133,245,552 P341S possibly damaging Het
Mcts2 A G 2: 152,687,689 E140G probably benign Het
Med1 T C 11: 98,169,438 M222V probably benign Het
Mef2a G T 7: 67,235,148 S406* probably null Het
Muc19 A T 15: 91,900,502 noncoding transcript Het
Nr1h2 A G 7: 44,552,260 probably benign Het
Olfr1361 C A 13: 21,659,146 R59L probably damaging Het
Olfr205 A T 16: 59,328,760 F250I probably damaging Het
Olfr682-ps1 A G 7: 105,128,218 V73A possibly damaging Het
Olfr71 A T 4: 43,706,592 probably null Het
P4hb G A 11: 120,568,244 T141I possibly damaging Het
Polr3a A G 14: 24,484,134 V101A probably benign Het
Pou4f2 A G 8: 78,435,240 S245P probably benign Het
Rnpep A G 1: 135,272,419 V266A probably damaging Het
Scly G A 1: 91,309,833 G206R probably damaging Het
Sec14l3 A T 11: 4,074,814 K254N probably damaging Het
Sgpp1 A T 12: 75,735,100 I155N probably damaging Het
Slc22a14 A G 9: 119,172,124 L468P probably damaging Het
Slc22a27 A G 19: 7,865,884 F377L probably benign Het
Slc44a3 T C 3: 121,460,070 I625V probably benign Het
Slc47a2 A T 11: 61,309,976 I373N probably damaging Het
Slfn10-ps A T 11: 83,035,653 noncoding transcript Het
Smarcd1 T A 15: 99,711,094 I383N probably damaging Het
Sort1 A G 3: 108,338,910 D401G probably damaging Het
Sprr2a3 G T 3: 92,288,590 M1I probably null Het
Sycp2 A C 2: 178,356,580 V1049G possibly damaging Het
Tecrl T A 5: 83,354,928 K10* probably null Het
Tnpo3 A T 6: 29,578,565 C303* probably null Het
Vmn2r23 A G 6: 123,729,721 I503M probably benign Het
Zbtb8os T A 4: 129,346,877 I164N probably damaging Het
Zfp292 T C 4: 34,807,399 N1882D probably benign Het
Zfp91 T C 19: 12,770,095 I555V possibly damaging Het
Other mutations in Cobl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Cobl APN 11 12375813 missense possibly damaging 0.89
IGL00698:Cobl APN 11 12253722 missense probably benign 0.41
IGL00772:Cobl APN 11 12266985 missense probably benign 0.02
IGL00922:Cobl APN 11 12254866 missense probably damaging 1.00
IGL00985:Cobl APN 11 12254843 missense probably damaging 1.00
IGL01641:Cobl APN 11 12309641 nonsense probably null
IGL01722:Cobl APN 11 12253987 missense probably benign 0.00
IGL01734:Cobl APN 11 12254980 splice site probably benign
IGL01924:Cobl APN 11 12254596 missense probably benign 0.30
IGL02105:Cobl APN 11 12249651 missense probably damaging 1.00
IGL02326:Cobl APN 11 12386712 missense possibly damaging 0.69
IGL02342:Cobl APN 11 12253672 missense possibly damaging 0.64
IGL02426:Cobl APN 11 12254351 nonsense probably null
IGL02754:Cobl APN 11 12254371 missense probably damaging 1.00
IGL02754:Cobl APN 11 12254370 missense probably damaging 1.00
IGL02811:Cobl APN 11 12253285 missense possibly damaging 0.56
IGL02859:Cobl APN 11 12369602 missense probably damaging 1.00
IGL02999:Cobl APN 11 12343869 missense possibly damaging 0.71
IGL03030:Cobl APN 11 12254241 missense possibly damaging 0.80
IGL03191:Cobl APN 11 12253364 missense probably benign 0.00
PIT4418001:Cobl UTSW 11 12256240 missense possibly damaging 0.79
PIT4480001:Cobl UTSW 11 12253592 missense probably benign
PIT4495001:Cobl UTSW 11 12254596 missense probably benign 0.00
R0031:Cobl UTSW 11 12254945 missense probably benign 0.36
R0241:Cobl UTSW 11 12254524 missense probably benign 0.25
R0241:Cobl UTSW 11 12254524 missense probably benign 0.25
R0322:Cobl UTSW 11 12267072 missense probably damaging 1.00
R0733:Cobl UTSW 11 12365167 missense probably benign 0.31
R0734:Cobl UTSW 11 12375971 missense probably damaging 1.00
R0784:Cobl UTSW 11 12266843 splice site probably benign
R0884:Cobl UTSW 11 12375908 missense possibly damaging 0.89
R1065:Cobl UTSW 11 12254327 missense possibly damaging 0.67
R1331:Cobl UTSW 11 12375853 missense probably damaging 0.96
R1892:Cobl UTSW 11 12253258 missense probably damaging 0.99
R2847:Cobl UTSW 11 12378342 missense probably damaging 1.00
R2848:Cobl UTSW 11 12378342 missense probably damaging 1.00
R3407:Cobl UTSW 11 12375830 missense probably damaging 1.00
R4627:Cobl UTSW 11 12251093 missense probably damaging 1.00
R4662:Cobl UTSW 11 12253672 missense probably benign 0.08
R4677:Cobl UTSW 11 12386665 missense possibly damaging 0.93
R4844:Cobl UTSW 11 12254740 missense probably benign 0.10
R4942:Cobl UTSW 11 12254185 missense probably damaging 0.99
R5158:Cobl UTSW 11 12256198 missense possibly damaging 0.84
R5195:Cobl UTSW 11 12253565 missense probably benign 0.02
R5255:Cobl UTSW 11 12375825 missense probably damaging 1.00
R5588:Cobl UTSW 11 12343886 nonsense probably null
R5637:Cobl UTSW 11 12296531 intron probably benign
R5643:Cobl UTSW 11 12306948 splice site probably benign
R5749:Cobl UTSW 11 12266965 missense possibly damaging 0.86
R5953:Cobl UTSW 11 12256220 missense probably benign 0.00
R6000:Cobl UTSW 11 12369684 missense probably benign 0.08
R6373:Cobl UTSW 11 12253118 missense probably damaging 1.00
R7034:Cobl UTSW 11 12254177 missense probably damaging 1.00
R7071:Cobl UTSW 11 12254795 missense probably benign 0.00
R7077:Cobl UTSW 11 12253441 missense probably benign 0.04
R7078:Cobl UTSW 11 12378271 missense probably damaging 1.00
R7099:Cobl UTSW 11 12296540 missense
R7153:Cobl UTSW 11 12254128 missense probably damaging 1.00
R7448:Cobl UTSW 11 12256225 missense possibly damaging 0.46
R7519:Cobl UTSW 11 12253124 missense probably damaging 1.00
R7767:Cobl UTSW 11 12412117 start gained probably benign
R7772:Cobl UTSW 11 12254488 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- TGTGACTAGAACCATGCACTTTGCC -3'
(R):5'- TCGTACCCTGAACCGTCATGGATAG -3'

Sequencing Primer
(F):5'- AGAACCATGCACTTTGCCTTTATC -3'
(R):5'- CCATAATCCCTGATAGTGGCGTG -3'
Posted On2013-07-11