Incidental Mutation 'R7108:Ralgapb'
ID551299
Institutional Source Beutler Lab
Gene Symbol Ralgapb
Ensembl Gene ENSMUSG00000027652
Gene NameRal GTPase activating protein, beta subunit (non-catalytic)
SynonymsB230339M05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7108 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location158409848-158499253 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 158494662 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1407 (I1407F)
Ref Sequence ENSEMBL: ENSMUSP00000105111 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046274] [ENSMUST00000109485] [ENSMUST00000109486] [ENSMUST00000141497]
Predicted Effect probably damaging
Transcript: ENSMUST00000046274
AA Change: I1391F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048430
Gene: ENSMUSG00000027652
AA Change: I1391F

DomainStartEndE-ValueType
low complexity region 166 178 N/A INTRINSIC
low complexity region 610 625 N/A INTRINSIC
low complexity region 775 788 N/A INTRINSIC
low complexity region 910 920 N/A INTRINSIC
low complexity region 1086 1097 N/A INTRINSIC
low complexity region 1309 1321 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109485
AA Change: I1407F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105111
Gene: ENSMUSG00000027652
AA Change: I1407F

DomainStartEndE-ValueType
low complexity region 166 178 N/A INTRINSIC
low complexity region 622 637 N/A INTRINSIC
low complexity region 791 804 N/A INTRINSIC
low complexity region 926 936 N/A INTRINSIC
low complexity region 1102 1113 N/A INTRINSIC
low complexity region 1325 1337 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109486
AA Change: I1395F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105112
Gene: ENSMUSG00000027652
AA Change: I1395F

DomainStartEndE-ValueType
low complexity region 166 178 N/A INTRINSIC
low complexity region 610 625 N/A INTRINSIC
low complexity region 779 792 N/A INTRINSIC
low complexity region 914 924 N/A INTRINSIC
low complexity region 1090 1101 N/A INTRINSIC
low complexity region 1313 1325 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000141497
AA Change: I1073F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116481
Gene: ENSMUSG00000027652
AA Change: I1073F

DomainStartEndE-ValueType
low complexity region 288 303 N/A INTRINSIC
low complexity region 457 470 N/A INTRINSIC
low complexity region 592 602 N/A INTRINSIC
low complexity region 768 779 N/A INTRINSIC
low complexity region 991 1003 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T C 11: 58,880,924 S411P probably damaging Het
4930503L19Rik A T 18: 70,468,476 Y112N probably benign Het
Abcd2 A T 15: 91,191,274 V112E probably benign Het
Acadm A T 3: 153,925,800 Y353* probably null Het
Adra2c A G 5: 35,279,998 D38G probably benign Het
Ankrd10 C T 8: 11,612,624 G370R probably damaging Het
Arfgef2 T A 2: 166,873,608 N1324K possibly damaging Het
Atp6v1b2 A G 8: 69,102,501 T172A probably damaging Het
BC003331 T C 1: 150,382,290 Y198C probably benign Het
Bloc1s1 T A 10: 128,922,723 K22M possibly damaging Het
Brpf3 A G 17: 28,817,125 T599A probably benign Het
Cacna1e TTCCAGTCTC TTC 1: 154,468,995 probably null Het
Casc1 G A 6: 145,185,865 Q351* probably null Het
Ccdc186 T C 19: 56,798,760 D592G probably damaging Het
Cfap161 A T 7: 83,793,310 D98E possibly damaging Het
Cfi G A 3: 129,875,016 V564M probably damaging Het
Cilp2 T A 8: 69,881,129 Q1073L probably damaging Het
Cox6b1 A G 7: 30,623,504 C40R possibly damaging Het
Cyp3a59 A T 5: 146,096,333 M172L probably benign Het
Cyth1 T C 11: 118,182,913 D198G probably damaging Het
Daam2 T C 17: 49,460,674 D963G probably damaging Het
Ddi2 A T 4: 141,705,937 D209E probably benign Het
Dnah12 G A 14: 26,778,912 probably null Het
Dpagt1 G T 9: 44,327,021 probably benign Het
Drc3 T A 11: 60,370,554 F177Y probably benign Het
Dsg2 T C 18: 20,601,863 V966A probably damaging Het
E430018J23Rik A G 7: 127,391,523 S431P probably benign Het
E4f1 A G 17: 24,444,578 V633A probably damaging Het
Eif2ak2 T A 17: 78,858,536 R411* probably null Het
Frem2 T C 3: 53,653,513 E1191G probably damaging Het
Fry T C 5: 150,395,786 V972A probably damaging Het
Fry T A 5: 150,491,090 C467S Het
Fscn1 T C 5: 142,960,515 Y23H probably damaging Het
Gm16506 T A 14: 43,724,302 I163F Het
Gm21103 T C 14: 6,303,774 Y92C probably damaging Het
Golgb1 A G 16: 36,913,721 H1151R probably benign Het
Gprc5c T C 11: 114,864,282 Y262H probably damaging Het
Hc G T 2: 35,039,694 N245K probably benign Het
Hps6 T A 19: 46,005,490 L622Q probably damaging Het
Hsd17b1 T C 11: 101,079,209 Y156H probably damaging Het
Ireb2 T A 9: 54,906,641 F799L probably damaging Het
Irf1 A G 11: 53,774,412 D205G probably damaging Het
Kif12 A T 4: 63,171,205 F103L probably benign Het
Krt12 C T 11: 99,416,052 V475M unknown Het
Lca5 T A 9: 83,423,169 T195S probably benign Het
Lrrc17 T C 5: 21,575,339 V437A possibly damaging Het
Malt1 G T 18: 65,464,051 D468Y probably damaging Het
Man2b2 C T 5: 36,815,485 A562T probably benign Het
Mrc1 C T 2: 14,304,146 Q794* probably null Het
Muc16 T A 9: 18,655,233 I1997L unknown Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,634,450 probably null Het
Mycbp2 A T 14: 103,122,603 F4518Y probably damaging Het
Myo5a T A 9: 75,129,992 I159N probably damaging Het
Nat1 T C 8: 67,491,020 V19A probably benign Het
Ndst4 A G 3: 125,561,471 T343A probably damaging Het
Nlrp9b A T 7: 20,045,930 L839F probably damaging Het
Nxnl1 A G 8: 71,566,554 I9T probably benign Het
Olfr1351 C A 10: 79,017,649 S109* probably null Het
Olfr331 T A 11: 58,502,554 M7L probably benign Het
Olfr364-ps1 C T 2: 37,146,260 T16I probably benign Het
Olfr548-ps1 A T 7: 102,541,992 I19F probably damaging Het
Olfr693 G A 7: 106,678,048 A146V probably benign Het
Pou5f2 T C 13: 78,025,265 S109P possibly damaging Het
Prkcz G A 4: 155,286,793 Q321* probably null Het
Prr18 G T 17: 8,341,531 R173L probably damaging Het
Sacs T A 14: 61,211,009 Y3501* probably null Het
Sall3 G A 18: 80,973,754 P320S probably benign Het
Scn8a A T 15: 101,039,778 H1676L probably benign Het
Shmt1 T C 11: 60,798,644 D178G probably damaging Het
Slmap T C 14: 26,422,521 K737R probably benign Het
Ssh2 G A 11: 77,454,794 V1202I probably benign Het
Stard7 A G 2: 127,295,494 D288G possibly damaging Het
Tek A T 4: 94,853,487 D827V probably damaging Het
Tfap2e A G 4: 126,720,563 L276P probably damaging Het
Tns3 T C 11: 8,437,251 N1312S probably benign Het
Tubd1 T A 11: 86,557,805 S315T probably damaging Het
Ube2f T A 1: 91,265,219 C50* probably null Het
Vmn2r109 T C 17: 20,564,744 I5V probably benign Het
Vmn2r39 T C 7: 9,023,668 T445A probably damaging Het
Other mutations in Ralgapb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Ralgapb APN 2 158420856 missense probably damaging 1.00
IGL00534:Ralgapb APN 2 158430500 missense possibly damaging 0.72
IGL01362:Ralgapb APN 2 158435465 missense probably damaging 1.00
IGL01653:Ralgapb APN 2 158462159 missense possibly damaging 0.94
IGL01704:Ralgapb APN 2 158420875 missense possibly damaging 0.92
IGL02000:Ralgapb APN 2 158454114 splice site probably benign
IGL02169:Ralgapb APN 2 158426204 missense probably damaging 1.00
IGL02516:Ralgapb APN 2 158465815 splice site probably benign
IGL02548:Ralgapb APN 2 158444665 missense probably damaging 0.97
IGL02550:Ralgapb APN 2 158448411 missense probably damaging 1.00
IGL02653:Ralgapb APN 2 158443309 missense probably damaging 1.00
IGL02744:Ralgapb APN 2 158446151 missense probably damaging 1.00
IGL02804:Ralgapb APN 2 158426284 missense possibly damaging 0.78
IGL02937:Ralgapb APN 2 158493016 splice site probably null
IGL02993:Ralgapb APN 2 158437394 missense possibly damaging 0.90
IGL03154:Ralgapb APN 2 158432866 missense probably damaging 1.00
IGL03204:Ralgapb APN 2 158465912 missense possibly damaging 0.67
IGL03347:Ralgapb APN 2 158465960 missense possibly damaging 0.67
PIT4142001:Ralgapb UTSW 2 158430422 missense probably benign 0.34
R0037:Ralgapb UTSW 2 158437411 missense probably damaging 1.00
R0037:Ralgapb UTSW 2 158437411 missense probably damaging 1.00
R0077:Ralgapb UTSW 2 158473249 missense probably damaging 1.00
R0581:Ralgapb UTSW 2 158492961 missense probably benign
R0629:Ralgapb UTSW 2 158439547 missense probably damaging 1.00
R0839:Ralgapb UTSW 2 158473283 critical splice donor site probably null
R1331:Ralgapb UTSW 2 158430533 missense probably damaging 1.00
R1468:Ralgapb UTSW 2 158462253 missense possibly damaging 0.95
R1468:Ralgapb UTSW 2 158462253 missense possibly damaging 0.95
R1540:Ralgapb UTSW 2 158465826 missense probably benign 0.00
R1572:Ralgapb UTSW 2 158446199 splice site probably benign
R1628:Ralgapb UTSW 2 158430463 missense probably benign 0.04
R1718:Ralgapb UTSW 2 158443280 nonsense probably null
R1777:Ralgapb UTSW 2 158462195 missense probably damaging 1.00
R1822:Ralgapb UTSW 2 158492452 missense probably damaging 0.99
R1903:Ralgapb UTSW 2 158495563 missense probably benign 0.04
R1909:Ralgapb UTSW 2 158444675 missense probably damaging 1.00
R2157:Ralgapb UTSW 2 158437472 missense probably benign 0.15
R4524:Ralgapb UTSW 2 158437306 missense probably benign 0.00
R4946:Ralgapb UTSW 2 158440967 missense probably damaging 1.00
R4975:Ralgapb UTSW 2 158435508 missense possibly damaging 0.66
R5014:Ralgapb UTSW 2 158495535 missense probably damaging 1.00
R5165:Ralgapb UTSW 2 158465912 missense possibly damaging 0.67
R5465:Ralgapb UTSW 2 158448405 missense possibly damaging 0.81
R5526:Ralgapb UTSW 2 158432785 missense probably damaging 1.00
R5566:Ralgapb UTSW 2 158494710 missense possibly damaging 0.90
R5949:Ralgapb UTSW 2 158454259 missense probably damaging 1.00
R6140:Ralgapb UTSW 2 158456572 missense probably damaging 1.00
R6175:Ralgapb UTSW 2 158446155 missense probably damaging 1.00
R6192:Ralgapb UTSW 2 158449447 intron probably null
R6364:Ralgapb UTSW 2 158462109 missense probably damaging 1.00
R6458:Ralgapb UTSW 2 158444620 missense probably damaging 1.00
R6746:Ralgapb UTSW 2 158476136 missense probably damaging 1.00
R6782:Ralgapb UTSW 2 158436566 missense probably damaging 0.99
R6788:Ralgapb UTSW 2 158436566 missense probably damaging 0.99
R7017:Ralgapb UTSW 2 158448337 missense probably benign 0.19
R7108:Ralgapb UTSW 2 158492460 missense probably damaging 0.98
R7236:Ralgapb UTSW 2 158440827 missense probably benign 0.34
R7454:Ralgapb UTSW 2 158432902 missense possibly damaging 0.94
R7485:Ralgapb UTSW 2 158443355 missense probably benign 0.35
R7595:Ralgapb UTSW 2 158426165 missense possibly damaging 0.91
R7615:Ralgapb UTSW 2 158450270 missense probably damaging 0.99
R7728:Ralgapb UTSW 2 158482503 critical splice donor site probably null
R7913:Ralgapb UTSW 2 158465939 missense probably damaging 1.00
R7994:Ralgapb UTSW 2 158465939 missense probably damaging 1.00
Z1177:Ralgapb UTSW 2 158435555 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGCAGCATAGGTTCCAAGG -3'
(R):5'- GGGGTGTACTCACTGACATC -3'

Sequencing Primer
(F):5'- GGTTCCAAGGAAAAATATTCTGAGC -3'
(R):5'- GGGTGTACTCACTGACATCCTATG -3'
Posted On2019-05-15